Información

2.4: El ciclo celular y los cambios en el contenido de ADN - Biología

2.4: El ciclo celular y los cambios en el contenido de ADN - Biología


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Cuatro etapas de un ciclo celular típico

El ciclo de vida de las células eucariotas generalmente se puede dividir en cuatro etapas y en la Figura ( PageIndex {13} ) se muestra un ciclo celular típico. Este período de retraso se llama Gap 1 (GRAMO1), y termina con el inicio de la síntesis de ADN (S) fase, durante la cual se replica cada cromosoma. Después de la replicación, puede haber otro retraso, llamado Gap 2 (GRAMO2), antes de la mitosis (METRO). Las células que se someten a meiosis no suelen tener un G2 fase. Interfase es un término utilizado para incluir aquellas fases del ciclo celular que excluyen la mitosis y la meiosis. Algunas células nunca abandonan G1 fase, y se dice que entran en una etapa permanente, que no se divide, llamada GRAMO0. Comprender el control del ciclo celular es un área activa de investigación, particularmente debido a la relación entre la división celular y el cáncer.

Medidas de contenido de ADN y contenido de cromosomas

La cantidad de ADN dentro de una célula cambia después de cada uno de los siguientes eventos: fertilización, síntesis de ADN, mitosis y meiosis (Fig. 2.14). Usamos "C"Para representar el ADN Content en una celda, y "norte"Para representar el nortenúmero de juegos completos de cromosomas. En un gameto (es decir, esperma u óvulo), la cantidad de ADN es 1c y el número de cromosomas es 1n. Tras la fertilización, tanto el contenido de ADN como el número de cromosomas se duplica a 2c y 2n, respectivamente. Después de la replicación del ADN, el contenido de ADN se duplica nuevamente a 4c, pero cada par de cromátidas hermanas todavía se cuenta como un solo cromosoma (un cromosoma replicado), por lo que el número de cromosomas permanece sin cambios en 2n. Si la célula sufre mitosis, cada célula hija volverá a 2c y 2n, porque recibirá la mitad del ADN y una de cada par de cromátidas hermanas. En contraste, las 4 células que provienen de la meiosis de una célula 2n, 4c son cada una 1c y 1n, ya que cada par de cromátidas hermanas y cada par de cromosomas homólogos se divide durante la meiosis.


2.4: El ciclo celular y los cambios en el contenido de ADN - Biología

Una revisión completa de los ensayos para el ciclo celular y los resultados de una encuesta de Labome de publicaciones formales.

El ciclo celular es el proceso por el cual las células eucariotas se duplican y se dividen. El ciclo celular consta de dos fases específicas y distintas: la interfase, que consta de G1 (Gap 1), S (síntesis) y G2 (Gap 2), y la fase mitótica M (mitosis) (Figura 1). Durante la interfase, la célula crece (G1), acumula la energía necesaria para la duplicación, replica el ADN celular (S) y se prepara para dividirse (G2) [2]. En este punto, la célula entra en la fase M, que se divide en dos etapas estrictamente reguladas: mitosis y citocinesis. Durante la mitosis, los cromosomas de una célula madre se dividen entre dos células hermanas. En la citocinesis, se produce la división del citoplasma, lo que conduce a la formación de dos células hijas distintas. Cada fase del ciclo celular está estrictamente regulada y existen puntos de control para detectar posibles daños en el ADN y permitir su reparación antes de que una célula se divida. Si el daño no se puede reparar, una célula se convierte en el objetivo de la apoptosis. Las células también pueden dejar de dividirse de forma reversible y entrar temporalmente en un estado de reposo o senescencia G0. El primer punto de control está al final de G1, para tomar la decisión de si una celda debe ingresar a la fase S y dividir, retrasar la división o ingresar a G0. El segundo punto de control, al final de G2, desencadena la mitosis si una célula tiene todos los componentes necesarios.

A continuación se analizan varios métodos para evaluar el ciclo celular. Sin embargo, es importante recordar que estos métodos no son mutuamente excluyentes, y para obtener los mejores y más confiables datos, se pueden combinar múltiples colorantes y / o analitos en un solo experimento o se pueden usar múltiples ensayos.

El método más común para evaluar el ciclo celular es usar citometría de flujo para medir el contenido de ADN celular. Durante este proceso, se incuba un tinte fluorescente que se une al ADN con una suspensión de células fijas o permeabilizadas. Dado que el tinte se une al ADN de forma estequiométrica, la cantidad de señal fluorescente es directamente proporcional a la cantidad de ADN. Debido a las alteraciones que ocurren durante el ciclo celular, el análisis del contenido de ADN permite discriminar entre las fases G1, S, G2 y M. El protocolo simple para el análisis celular se describe en la Figura 2. Brevemente, las células se fijan y permeabilizan para permitir que los tintes entren en la célula y evitar que se exporten. La tinción con el tinte de unión al ADN se produce después de que las células hayan sido tratadas con RNasa para garantizar que solo se mida el ADN. Se recopilan varios conjuntos de datos, que incluyen dispersión directa frente a dispersión lateral, área de pulso frente a ancho de pulso y recuento de células frente a yoduro de propidio, para garantizar que solo se midan células individuales. En la Figura 3 se muestran ejemplos de estos rastros.

Hay varios tintes diferentes que se pueden usar en estos ensayos, incluido el yoduro de propidio (PI) [3, 4], 7-amino actinomicina-D (7-AAD), Hoechst 33342 y 33258, y 4'6'-diamidino- 2-fenilindol (DAPI). Por ejemplo, Chopra S et al etiquetaron células dendríticas derivadas de médula ósea de ratón y suspensiones de células individuales de pata con 0,5 μg / ml de DAPI de Thermo Fisher durante la citometría de flujo en un instrumento BD LSR II y la clasificación celular con un clasificador de células BD Aria II SORP [ 5]. Zhang H et al combinaron tinción de anticuerpos anti-pMPM2 específicos de mitosis (05-368 de MilliporeSigma) con DAPI para obtener células en prometafase a través de FACS [6]. Sin embargo, la mayoría de las máquinas FACS comúnmente utilizadas contienen solo láseres de iones de argón y, como tales, los tintes que requieren activación UV, como DAPI y Hoescht 33342, se usan con menos frecuencia. Un derivado del colorante Hoechst, SiR-Hoechst, tiene excitación a 640 nm y, por lo tanto, puede encontrar un uso generalizado [7]. Hoechst 33258 también se ha utilizado para obtener imágenes de cuerpos de polycomb [8]. Rhodes JDP et al estimaron la proporción de células mitóticas mediante tinción de anticuerpos de histona H3 fosforilada con serina 10 en FACS [8]. La tinción de histona H3 fosforilada también se ha utilizado en inmunohistoquímica para identificar células mitóticas en ratones [9, 10] y killis [11].

Al realizar estos análisis, es importante reconocer que el análisis FACS de tinción simple simple utilizando 7-AAD o PI no puede distinguir entre las células en G1 o G2 de las que se encuentran en la fase S muy temprana o muy tardía, y de manera similar las de G2 o M. Por tanto, a veces es necesario combinar estos tintes con un marcador proliferativo como BrdU [3]. Por ejemplo, Calvanese V et al combinaron tinción con 7AAD y BrdU-PE en citometría de flujo para evaluar las etapas del ciclo celular de células madre o progenitoras hematopoyéticas cultivadas [12]. Esto requiere pasos adicionales al comienzo del estudio, donde las células vivas aún en cultivo se incuban con BrdU durante un período de aproximadamente 30 minutos, antes de la incubación con anticuerpos secundarios anti-BrdU y conjugados con fluorescencia. A continuación, se analizan las células como se describe anteriormente.

Hay una serie de consideraciones importantes al realizar análisis de datos FACS del ciclo celular. Los diagramas de dispersión hacia adelante / dispersión lateral son una parte integral del análisis y no deben pasarse por alto, ya que así es como se identifican las celdas individuales. Si se permiten dobletes (cuando el contenido de ADN de dos células en G1 se registra como un solo evento G2 / M) en el análisis, puede conducir a una sobrerrepresentación de G2 / M. También se deben evitar los agregados celulares y las velocidades de flujo por debajo de 1000 celdas / segundo para permitir el uso de un diferencial de presión de muestra bajo, lo que conduce a un coeficiente de varianza (CV) óptimo. Por último, las muestras de referencia que contienen ADN diploide normal deben incluirse como control adicional.

El ensayo de Nicoletti [13] es una forma modificada de análisis FACS del ciclo celular que permite al mismo tiempo evaluar la apoptosis midiendo células con bajo contenido de ADN intacto y alto contenido de ADN fragmentado [14] (el pico pre-G1). El método Nicoletti es muy similar al descrito anteriormente, con la excepción de que se usa un tampón hipotónico (como el tampón HFS que contiene citrato de sodio y Triton X-100, o una solución de fluorocromo hipotónico) para permeabilizar las células. Las células apoptóticas se tiñen más débilmente en estos ensayos debido a la activación de nucleasas celulares y la difusión de ADN de bajo peso molecular fuera de la célula. Las células fijadoras y permeabilizantes estimulan la liberación de oligo y mononucleosomas. El uso de un tampón hipotónico facilita la pérdida de ADN fragmentado, lo que resulta en un cambio del pico pre-G1.

Las imágenes de la Figura 4 muestran células sanas (arriba), células en las que una subpoblación comienza a sufrir apoptosis (centro) y una población de células con apoptosis extensa (abajo). Sin embargo, cuando se utiliza el ensayo de Nicoletti, se debe tener cuidado de discriminar los núcleos apoptóticos de los restos celulares y asegurarse de que no se produzca corte del ADN durante los procesos de fijación y tinción.

Las ciclinas son componentes reguladores clave de la maquinaria del ciclo celular. La familia de las ciclinas comprende las ciclinas clásicas, las quinasas dependientes de ciclinas [15, 16] (CDK) y los inhibidores de Cdk (CKI). Aunque hay mucha redundancia entre las ciclinas individuales y las CDK [17], la actividad y expresión de las proteínas individuales fluctúan durante cada fase distinta del ciclo celular, desempeñando un importante papel regulador. Aunque este es un proceso complejo y altamente regulado, en general las ciclinas se pueden dividir en subgrupos gobernados por la fase del ciclo celular que regulan, resumida en la Figura 5. Por ejemplo, la Ciclina D1 es necesaria para el paso de células de G0 a G1. Una vez expresada, forma un complejo con Cdk4, que activa la proteína del retinoblastoma, lo que conduce a la regulación positiva de la ciclina E. La ciclina E, en combinación con la ciclina A, luego interactúa con Cdk2 para promover la transición G1 / S. Por el contrario, las ciclinas B1 y B2 se expresan durante la fase M donde interactúan con Cdk1 para formar parte del MPF (fase M / factor promotor de la maduración), un ensamblaje que regula una cascada de procesos que conducen al ensamblaje del huso mitótico y, en última instancia, a la división celular. La expresión de cada ciclina humana y su interacción con Cdks se resumen en la tabla 1.

Ciclina Fase de pico expresada Socios vinculantes de cdk Los tres principales proveedores
DG1Cdk4, Ckd6CCND1: Invitrogen MA1-39546 (335), Tecnología de señalización celular 2978 (93), Santa Cruz Biotechnology sc-20044 (38)
miG1 / SCdk2CCNE1: Santa Cruz Biotechnology sc-247 (41), Tecnología de señalización celular 4129 (36), Invitrogen MA5-14336 (22)
AS / G2Cdk1, Cdk2CCNA1: Tecnología de señalización celular 4656 (23), Santa Cruz Biotechnology sc-271682 (5), R&D Systems MAB7046 (2)
BMETROCdk1CCNB1: Santa Cruz Biotechnology sc-245 (87), Tecnología de señalización celular 4135 (32), Invitrogen MA5-14319 (23)

Por tanto, estos patrones de expresión distintos pueden explotarse durante el análisis del ciclo celular. Los niveles totales y / o el estado de fosforilación de ciclinas individuales pueden medirse fácil y rápidamente utilizando anticuerpos específicos mediante inmunotransferencia [3]. Además, se encuentran disponibles kits de ELISA específicos para componentes individuales de la familia de ciclinas, lo que permite una evaluación más cuantitativa de la expresión. Finalmente, los anticuerpos conjugados con fluorescencia pueden usarse en enfoques inmunohistoquímicos o inmunocitoquímicos, o en citometría de flujo. La combinación de la tinción con ciclina con métodos FACS que examinan el contenido de ADN proporciona una herramienta poderosa y cuantitativa para analizar el ciclo celular con precisión [3].

Las células tetraploides están asociadas con la formación de malignidad y, a menudo, poseen las características de las células madre. Por lo tanto, con relevancia para la biología del cáncer [18, 19] y la homeostasis del tejido regenerativo [20], es concebible que el análisis de células tetraploides sea de importancia. Las células tetraploides G1 y las células diploides G2 / M son difíciles de detectar ya que poseen la misma ploidía que es el contenido de ADN 4C.

El sistema FUCCI (indicador del ciclo celular basado en ubiquitinación de fluorescencia) es una tecnología que utiliza la expresión de proteínas específicas de fase del ciclo celular y su degradación por el sistema de degradación ubiquitina-proteasoma [21, 22]. La tecnología analiza las células vivas de manera espacio-temporal utilizando quimeras fluorescentes de proteínas de dos colores. Además, permite superar el problema de aislar las células en diferentes fases, que de otro modo es difícil de diferenciar solo con tinciones basadas en ADN como Hoechst. Está compuesto por dos proteínas: Cdt1 (transcripción 1 dependiente de Cdc10) y Geminin. Ambas proteínas se utilizan en sus formas truncadas (hCdt1 y hGeminin) y se conjugan con dos proteínas fluorescentes diferentes. Se expresan alternativamente en las dos fases diferentes del ciclo celular. Cdt1 es un factor de replicación conservado necesario para autorizar el cromosoma para la síntesis de ADN. Cdt1 se expresa a lo largo de la fase G1 y se ubiquitina por el complejo de ubiquitina ligasa SCFSkp2 durante las fases S y G2 / M seguido de su degradación por el proteasoma. Por el contrario, la geminina inhibe la actividad de concesión de licencias de Cdt1 al interferir con la unión de los factores de concesión de licencias al origen de replicación durante la fase S. Está presente durante las fases S / G2 / M. Al final de la fase M ya lo largo de la fase G1, la geminina es ubiquitinada por el complejo de ligasa E3 APCcdh1 y degradada por el proteasoma [21].

Proveedor Equipo Referencias
Caltag MedsystemsFUCCI
Ciencias de la vida MBLFUCCI [23]
Takara Pharmaceuticals Vectores de fucci
ThermoFisher Scientific Sensor de ciclo celular Premo ™ FUCCI (BacMam 2.0) [24, 25]

La Figura 6 muestra el diagrama de dispersión que representa las células vivas que expresan diferentes fluorocromos que implican sus diversas fases del ciclo celular. Dependiendo de la selección de la sonda, las dos quimeras emiten una fluorescencia diferente. Varias sondas están disponibles comercialmente. Uno de los ejemplos se muestra a continuación junto con un diagrama. Fucci-G1 Red es una proteína de fusión de un fragmento de Cdt1 humano (aminoácidos 30-120) con el rojo fluorescente mCherry-RFP, que detecta las células en fase G1. Fucci-S / G2 / M Green es una proteína de fusión de un fragmento de geminina humana (aminoácidos 1-110) con la proteína verde fluorescente mAG1 (monomérica Azami-Green1) que visualiza las fases S, G2 y M. Por tanto, los tetraploides G1 emiten fluorescencia roja y los tetraploides G2 / M emiten fluorescencia verde. Empleando esta tecnología, también es posible distinguir entre las células diploides mononucleadas de las células binucleadas.

La Tabla 2 enumera algunos de los proveedores comerciales de kits FUCCI. Los sensores FUCCI de Thermo Fischer Scientific, por ejemplo, se utilizaron para analizar la fase G1 en células madre de ratón y evaluar los mecanismos de daño mediado por UV [24] e investigar el despertar y la proliferación de células metastásicas latentes por redes extracelulares de neutrófilos [25]. M Barnat et al obtuvieron pCAG-Geminin-GFP y pCAGCdt1-mKO2 de A. Miyawaki, RIKEN Brain Science Institute, Japón [10].

Una de las limitaciones del sistema FUCCI es que estos sistemas requieren la expresión de múltiples construcciones informadoras intracelularmente y reduce la posibilidad de obtener imágenes de otros objetivos espectralmente. Este problema se ha superado modificando este sistema. Zerjatke et al desarrollaron un antígeno nuclear de células proliferantes endógenas (PCNA) marcado con fluorescencia como un indicador del ciclo celular todo en uno. Este reportero con PCNA-mRuby se altera en brillo y localización en diferentes fases. En consecuencia, proporciona una lectura de la fase del ciclo celular, incluida la inactividad y la dinámica cuantitativa de los determinantes del destino individual de la regulación del ciclo celular [26].

Otra limitación es que el sistema FUCCI y sus variantes permiten visualizar si las células se encuentran dentro de una de las fases proliferativas (S, G2 o M) del ciclo celular, no reportan visualización simultánea de las células de las tres fases en tiempo real. Bajar et al desarrollaron un método robusto que permite la obtención de imágenes simultáneas de las cuatro fases. Establecieron un reportero intensiométrico para la transición S / G2 y además diseñaron una proteína fluorescente de color rojo lejano, mMaroon1, para rastrear el proceso de condensación de la cromatina mitótica. Diseñaron una nueva versión llamada Fucci4 combinando los nuevos reporteros con el sistema FUCCI e incorporando cuatro indicadores fluorescentes ortogonales que permiten capturar todas las fases del ciclo celular en las células vivas [27]. Fucci4 tiene diversas aplicaciones en desarrollo, fisiología y cáncer. Fucci4 permite 1) cómo diversos cambios a nivel molecular, genético y de señalización extracelular alteran el ciclo celular, 2) los mecanismos moleculares que regulan las transiciones de fase específicas y 3) el cribado de fármacos que afecten a una determinada fase del ciclo celular o distribución del ciclo celular.

Existen varias aplicaciones del sistema FUCCI en diversas ramas de la biología y la medicina. Para estudiar la biología del desarrollo, Sugiyama et al generaron líneas de pez cebra transgénicas que expresan las contrapartes FUCCI no mamíferas [28]. Fueron empleados para estudiar la regulación espacio-temporal de la progresión del ciclo celular durante los principales eventos / procesos morfogenéticos (gastrulación, metamorfosis, involución, invaginación y ramificación) [21, 29]. Zielke et al diseñaron un sistema FUCCI específico de Drosophila (Fly-FUCCI) que implica la expresión específica de tejido de las sondas FUCCI [30]. Esto permite distinguir las fases G1, S y G2 de la interfase. Esto sirve como una herramienta valiosa para visualizar la actividad del ciclo celular durante el desarrollo, la homeostasis tisular y el crecimiento neoplásico.

El sistema FUCCI se puede utilizar en tumores para la elaboración de perfiles del ciclo celular in vivo mediante la transfección estable de líneas celulares con indicadores FUCCI y el desarrollo de tumores de xenoinjerto [31]. Nico Battich et al correlacionaron las tasas de síntesis y degradación de los ARNm a lo largo del ciclo celular indicado por el sistema FUCCI [32].

Sawano et al rediseñaron el sensor basado en Cdt1 del sistema Fucci original para responder a la ubiquitinación mediada por CUL4Ddb1 específica de fase S sola o en combinación con ubiquitilación mediada por SCFSkp2. Este sistema se conoce como Fucci (CA) y delimita la interfase con los límites entre G1, S y G2. Las aplicaciones de Fucci (CA) incluyeron el seguimiento de la fase G1 transitoria de las células madre embrionarias de ratón que se dividen rápidamente y la identificación del daño por radiación UV en la fase S [24].

Recientemente se han desarrollado varios reactivos nuevos para el análisis del ciclo celular, como los cromocuerpos y el reactivo Cycletest. Los cromocuerpos son proteínas de fusión que contienen fluoresceínas unidas al dominio de unión al antígeno de los anticuerpos de cadena pesada. Estos reactivos se utilizan para detectar la expresión de diversas proteínas intracelulares dentro de los compartimentos celulares y cambios dinámicos de su distribución durante las diferentes fases del ciclo celular. Además, los cromocuerpos se pueden aplicar para la detección de proteínas tanto citoesqueléticas como nucleares. Con respecto a las proteínas diana del citoesqueleto, los cambios en la expresión de la vimentina han sido analizados por cromocuerpos específicos en un estudio que generó una línea celular de eliminación de vimentina [33]. En cuanto al análisis de proteínas nucleares por cromocuerpos, el antígeno nuclear celular proliferante (PCNA), que juega un papel crucial en el proceso de replicación en el núcleo, fue detectado por el cromocuerpo unido a proteína rojo fluorescente [34]. Además, recientemente se ha informado de una modificación avanzada de la detección de PCNA por cromocuerpos, que se basó en un análisis cuantitativo 4D de la expresión y distribución de PCNA durante la fase de replicación [35].

Además, los ensayos de cromocuerpos se pueden combinar con otras técnicas. Por ejemplo, se ha descrito una combinación de análisis del ciclo celular basado en cromocuerpos con el método de citotoxicidad Chto Tox-Glo. En ese estudio, la visualización de la expresión de PCNA en los compartimentos subcelulares por los cromocuerpos fue seguida por la evaluación de la actividad de la proteasa. in vitro [36]. Con respecto a las aplicaciones de los cromocuerpos para en vivo En la investigación, el método basado en cromocuerpos se aplicó originalmente a estudios en pez cebra [37]. Además, Wegner et al han analizado la expresión de actina en el cerebro de ratón utilizando cromocuerpos anti-actina marcados con la proteína fluorescente mNeptune2. [38].

proveedoresreactivos / kits métodos referencias de muestra
Becton Dickinson7-aminoactinomicina D [39]
BioLegendVioleta CytoPhasecitometría de flujo [40]
MilliporeSigma7-aminoactinomicina D [41]
MilliporeSigmaHoechst 33258 [42]
MilliporeSigmaHoechst 33342 [39]
MilliporeSigmaYoduro de propidio
Thermo Fisher7-aminoactinomicina D [43]
Thermo FisherHoechst 33258 [44]
Thermo FisherHoechst 33342
Thermo FisherYoduro de propidio

Además, se recomienda el kit de reactivos Cycletest PLUS producido por BD Biosciences para el análisis del ciclo celular. Este método incluye la eliminación de la membrana celular y el citoesqueleto con un detergente y tripsina, respectivamente, seguido de la digestión del ARN y la estabilización de la cromatina. El kit contiene yoduro de propidio (PI), que se une a los núcleos extraídos. Los núcleos teñidos se analizan mediante citometría de flujo para medir la unión de PI al ADN. Este reactivo se utilizó con éxito en varios estudios recientes. Por ejemplo, Cycletest se ha aplicado para evaluar los efectos antitumorales de la timoquinona en las células MCF-7 de tumores de mama humanos [45] y los efectos de la α-solanina en las células tumorales colorrectales [46].

Esta sección es proporcionada por Labome para ayudar a guiar a los investigadores a identificar los kits de ensayo de análisis del ciclo celular más adecuados. Labome examina las publicaciones formales. La Tabla 3 enumera los principales proveedores de reactivos / kits utilizados en los ensayos basados ​​en células y su número de publicaciones en la encuesta de Labome. El artículo de revisión sobre proliferación celular enumera los resultados de la encuesta sobre BrDU.

Este artículo se deriva de una versión anterior de un artículo escrito por la Dra. Laura Cobb "Ensayos basados ​​en células: el ciclo celular, la proliferación celular y la muerte celular", escrito en febrero de 2013. La Dra. Samayita Das contribuyó a la sección sobre FUCCI sistema en septiembre de 2019.


Biología de la dicha

El ciclo celular se refiere al ciclo de vida de una célula eucariota. En un momento dado, las células del cuerpo se encuentran en una de dos fases diferentes de su vida:

Interfase: constituye el 90% de la vida útil de una célula. Esta es la fase en la que la célula está creciendo, realizando funciones normales y duplicando su material genético. Hay tres etapas de interfase:

Fase G1 & # 8211 La celda está creciendo.

Fase S & # 8211 Fase de síntesis. Aquí, el ADN se está replicando.

Fase G2 & # 8211 En esta fase, la célula está comprobando dos veces para asegurarse de que no se cometieron errores al copiar el ADN.

Mitosis: Una parte muy corta del ciclo celular. En la mitosis, la célula se divide en dos para crear dos nuevas células hijas idénticas. Hay varias etapas que componen la mitosis.

Profase y # 8211 la célula se PREPARA para dividirse. El ADN de la cromatina se condensa en cromosomas en forma de & # 8220X & # 8221. El huso de los centriolos comienza a formarse.

Metafase y # 8211 Los cromosomas se alinean en el MEDIO del citoplasma celular. El huso de los centriolos se adhiere al centrómero de los cromosomas.

Anafase & # 8211 Los cromosomas tiran de APART, con cada cromátida hermana tirando hacia ambos lados de la célula.

Telofase y # 8211 Con los cromosomas ahora ubicados en el lado opuesto de la célula, la membrana nuclear comienza a reformarse alrededor de ellos. Las fibras del huso de los centriolos desaparecen y la membrana celular comienza a pellizcarse para convertirse en DOS células separadas.

Citocinesis y # 8211 Esta etapa del ciclo celular ocurre después de que termina la mitosis. En esta fase, la membrana celular se escinde, o SE CORTA por la mitad y se forman dos nuevas células hijas. Estas células hijas son idénticas a la célula madre. En las células vegetales, se construye una nueva sección de la pared celular llamada placa celular para separar las dos nuevas células hijas.


La liberación de la detención del ciclo celular con inhibidores de Cdk4 / 6 genera una progresión del ciclo celular altamente sincronizada en el cultivo de células humanas

Cada enfoque utilizado para sincronizar la progresión del ciclo celular de las líneas celulares humanas presenta un conjunto único de desafíos. La sincronía de inducción con agentes que bloquean transitoriamente la progresión a través de etapas clave del ciclo celular son populares, pero cambian las estequiometrías de los reguladores del ciclo celular, invocan cambios compensatorios en la tasa de crecimiento y, para los inhibidores de la replicación del ADN, dañan el ADN. La producción, sustitución o manipulación de una molécula diana debe ser excepcionalmente rápida si la interpretación de los fenotipos en el ciclo en estudio ha de permanecer independiente de los impactos sobre la progresión a través del ciclo anterior. Mostramos cómo se evitan estos desafíos mediante la explotación de la capacidad de los inhibidores de Cdk4 / 6, palbociclib, ribociclib y abemaciclib para detener la progresión del ciclo celular en el punto de control natural para el compromiso del ciclo celular: el punto de restricción. Después de que trabajos anteriores no encontraron cambios en el acoplamiento del crecimiento y la división durante la recuperación de la inhibición de CDK4 / 6, encontramos altos grados de sincronía en la progresión del ciclo celular. Aunque validamos la sincronización de inducción de CDK4 / 6 con hTERT-RPE-1, A549, THP1 y H1299, es eficaz en otras líneas y evita el daño del ADN que acompaña a la sincronización por bloqueo / liberación de timidina. La capacidad para volver al ciclo después de 72 h de parada permite la inducción / manipulación del objetivo fuera del ciclo, sin afectar a los ciclos anteriores.

1. Antecedentes

La progresión sincronizada a través del ciclo de división celular a lo largo de una población apoya la capacidad de extrapolar los atributos bioquímicos y funcionales de la población a granel sincronizada para inferir el comportamiento en una célula individual [1, 2]. Muchos enfoques son populares. Los niveles masivos de ADN o marcadores del ciclo celular apoyan el fraccionamiento de poblaciones de células vivas o fijas en grupos enriquecidos para etapas discretas del ciclo celular [3, 4]. Aunque los rendimientos son bajos, la sincronización de selección basada en el tamaño o la sacudida mitótica son enfoques muy eficaces para aislar células en una fase de ciclo de una gran población de células asincrónicas con un impacto mínimo sobre el proteoma [5-9]. Sin embargo, la facilidad de la sincronía de inducción lo convierte en el enfoque más ampliamente aplicado.

La sincronía de inducción explota la capacidad de la exposición transitoria a un contexto particular para acumular células en una etapa discreta del ciclo celular, antes de que la eliminación del contexto libere simultáneamente todas las células de la población, para progresar sincrónicamente a través de las fases posteriores del ciclo de división celular [1]. En las levaduras, predominan la ablación transitoria de los reguladores del ciclo celular a través de mutaciones condicionales reversibles y la adición de feromonas de apareamiento [10, 11]. Aunque el advenimiento de las versiones sensibles a los análogos de las quinasas del ciclo celular ha introducido enfoques genéticos químicos análogos en los estudios de cultivo de tejidos humanos [12-15], la sincronía de inducción a través de la inanición de suero [16], la inhibición por contacto [17] o la activación de la replicación del ADN , o montaje de husillo, los puntos de control [7,18] siguen siendo los más utilizados. Sin embargo, es importante señalar que cada forma de detención superpone cambios específicos en el transcriptoma y el proteoma sobre la firma de detención del ciclo celular central [19-21]. Estas rutas específicas a la salida del ciclo celular se reflejan en diferentes rutas de retorno a los ciclos sincronizados [22]. Por lo tanto, el aparente reflejo de la progresión del ciclo celular normal logrado con la sincronización de la selección aún no ha sido igualado por los enfoques actuales de la sincronización por inducción [4, 9, 21].

El descubrimiento de que el tratamiento transitorio con timidina sincronizaba la progresión mitótica [18] condujo a protocolos que agudizaron el grado de sincronía al imponer un segundo bloqueo de timidina antes de liberar las células en el ciclo de estudio [23-26]. Este "doble bloqueo de timidina" sigue siendo una de las opciones más populares; sin embargo, el poder de este enfoque, su dependencia del punto de control de la replicación del ADN para detener la progresión de la fase S, con horquillas de replicación del ADN estancadas, tiene un costo. Aunque la detención del ciclo celular es robusta en muchas líneas, las bifurcaciones estancadas son propensas a colapsar durante la detención prolongada y los intentos posteriores de reparación introducen daños y reordenamientos cromosómicos [27-31]. También hay informes de impactos comprensibles sobre la biología del ARN y el proteoma durante la detención de la fase S extendida [21, 32, 33]. Por lo tanto, este enfoque popular puede tener una utilidad limitada en el estudio de la replicación del ADN y algunos eventos transcripcionales y asociados a la cromatina.

Cuando se van a analizar los eventos tempranos del ciclo celular, la sincronía de inducción a través de la liberación de una detención mitótica en el ciclo celular anterior proporciona una alternativa atractiva. Sin embargo, al igual que otras formas de sincronía de inducción que detienen dentro de Durante el ciclo, la detención prolongada del ciclo celular generará un desequilibrio en los numerosos reguladores, cuyos niveles fluctúan con la progresión del ciclo celular, como consecuencia de la transcripción y / o destrucción dependientes de la etapa [21,34,35]. En consecuencia, el ciclo siguiente bien puede verse alterado por actividades reguladoras excesivas, o sustratos, heredados del ciclo anterior, detenido. Estudios incisivos de Ginzberg et al. [36] reveló cómo las contramedidas para compensar algunos desequilibrios promueven ajustes en las tasas de crecimiento en dos puntos del ciclo. Además, la detención mitótica prolongada puede iniciar la salida mitótica atípica denominada deslizamiento mitótico [35,37], desencadenar vías apoptóticas [38] y / o dejar un recuerdo de la detención mitótica que modifica la progresión del ciclo celular en el siguiente ciclo y más allá [39– 42].

Por lo tanto, aunque son muy informativos para algunas preguntas, los datos obtenidos a través de enfoques tradicionales de sincronía de inducción, que se basan en el arresto dentro de el ciclo, hay que interpretarlo con cautela. Deben consolidarse con datos complementarios de enfoques alternativos para revelar los puntos en común que excluyen los artefactos incurridos en cada enfoque distinto de sincronización.

Un desafío adicional en la sincronización de la progresión del ciclo celular en una población surge cuando existe la necesidad de evaluar el impacto del agotamiento, inducción o reemplazo de proteínas. Es fundamental garantizar que la destrucción, inducción o activación de una variante mutante comience después de que se complete el procedimiento de sincronización. De lo contrario, el fenotipo puede ser un legado que surge de la perturbación de la progresión a través del ciclo anterior, en lugar de un impacto directo sobre el ciclo que se está estudiando. Los avances en las tecnologías degron y PROTAC (PRoteolysis TArgeting Chimera) pueden superar muchos de estos desafíos [43-45]. Sin embargo, incluso con muchos enfoques de sincronización de inducción, el cambio de una versión de una proteína a otra debe ser excepcionalmente rápido y completo si se quiere evitar la perturbación del ciclo anterior.

Inspirados por el poder de la sincronización de inducción de feromonas en la fase G1 de los ciclos de células de levadura [11, 46], exploramos la utilidad de la sincronía de inducción con los inhibidores de CDK4 / 6 palbociclib, ribociclib y abemaciclib. Estos inhibidores detienen la progresión del ciclo celular de células de cultivo de tejidos de mamíferos en el punto de restricción en la fase G1, antes de comprometerse con el ciclo celular [47, 48]. La sincronización por inducción desde el punto de pausa natural en el ciclo tiene varios atributos atractivos. En primer lugar, el programa del ciclo celular aún no se ha puesto en marcha. En segundo lugar, la detención prolongada mediante la inhibición de Cdk4 / 6 no invoca cambios compensatorios en el ciclo celular o en los controles del crecimiento, sino que simplemente ajusta el control del tamaño celular [36]. Por último, la detención del ciclo celular impuesta por palbociclib tiene menos impacto sobre el transcriptoma que los cambios específicos del tipo celular observados en la sincronización mediante la inhibición por contacto y la privación de suero [19,20].

Las quinasas Cdk4 y Cdk6 determinan el compromiso con el ciclo celular de muchas células [48]. Se asocian con la ciclina D y los miembros p21 y p27 de la familia Kip para generar complejos de quinasa trimérica activos que fosforilan el extremo C de la proteína de la familia del retinoblastoma (Rb) [49-54]. Esta monofosforilación apoya la fosforilación adicional de Rb por los complejos Cdk1 / Cdk2-Ciclina E y Cdk1 / Cdk2-Ciclina A [13]. El Rb hipo-fosforilado se une estrechamente a los factores de transcripción de la familia E2F, para bloquear la transcripción de genes necesarios para el compromiso del ciclo celular. La dilución de Rb y la hiperfosforilación alivia esta inhibición para promover la transcripción de genes del ciclo celular, incluidos Emi1, Cyclin E y Cyclin A [55]. La inducción de estas ciclinas aumenta rápidamente la fosforilación de Rb por los complejos Ciclina E y Ciclina A Cdk [56]. Los complejos Emi1, Ciclina E y Ciclina A sellan el compromiso con el ciclo inhibiendo el complejo promotor de la anafase / ciclosoma (APC / C) que activa el componente Cdh1, estabilizando así los objetivos de APC / C Cdh1, incluida la Ciclina A [57-61].

El papel clave desempeñado por Cdk4-Cyclin D y Cdk6-Cyclin D en presidir la proliferación celular, y el contraste entre la capacidad de los ratones para sobrevivir a la ablación genética de Cdk4, Cdk6 y Cyclin D y la adicción de líneas cancerosas a estas quinasas, impulsó el desarrollo de inhibidores de Cdk4 / 6 clínicamente exitosos [62-66]. Estos inhibidores se unen a los dímeros inactivos Cdk4-Ciclina D y Cdk6-Ciclina D, en lugar de los complejos triméricos activos, pero imponen una detención del ciclo celular muy eficaz [54]. Se ha propuesto que este impacto contrario a la intuición se debe al secuestro de los dímeros inactivos o quinasas monoméricas por parte de los fármacos. En este modelo, este secuestro libera p21 y p27 para elevar las concentraciones de estos inhibidores de Cdk2, a un nivel en el que bloquean la capacidad de los complejos Cdk2-Ciclina A y Cdk2-Ciclina E para promover los ciclos de retroalimentación y los eventos de la fase S que impulsan el compromiso. al ciclo [48,54,67]. Cada fármaco tiene un perfil específico "fuera del objetivo". La impresionante especificidad de ribociclib es casi igualada por palbociclib, mientras que abemaciclib muestra importantes impactos fuera del objetivo, con actividades notables hacia los complejos Cdk1, Cdk2, Cdk7 y Cdk9, que pueden inducir una detención en G2 junto con G1 [68]. Paradójicamente, este impacto fuera del objetivo puede explicar la mayor eficacia de abemaciclib en algunos entornos clínicos [68,69].

Describimos cómo la sincronía de inducción de Cdk4 / 6 genera una progresión altamente sincrónica a través de los ciclos celulares de varias líneas, sin la aparición marcada de un marcador de daño en el ADN, focos de tinción con anticuerpos que reconocen la serina 139 de la histona γ-H2AX cuando se está fosforilado (γ-H2AX), que acompaña a la sincronización de inducción de timidina. La capacidad de volver al ciclo después de 72 h de detención en G1 con palbociclib apoyará una amplia gama de manipulaciones en el estado de detención, sin ciclos [70]. Por lo tanto, cualquier impacto sobre la progresión a través del ciclo de estudio no será una consecuencia secundaria de la perturbación del ciclo celular anterior.

2. Métodos

2.1. Líneas celulares y cultivo celular

Las líneas celulares utilizadas en este estudio se enumeran en el material complementario electrónico, tabla S1. Una vez recibidas, las líneas se expandieron y congelaron en alícuotas de 1 x 10 6 células que se expandieron por al menos dos ciclos de paso continuo antes de cada experimento. A menos que se indique lo contrario, hTERT-RPE-1, A549, GP2d, LoVo, U2OS, DLD-1, HCT 116, HeLa, A172, HMBC, HEK293, HEK293T y H157 se mantuvieron en medio de águilas modificado de Dulbecco con alto contenido de glucosa (DMEM: D6546, Sigma Aldrich) suplementado con FBS al 10% (Hyclone, South American Origin, SV30160.03, GE Healthcare) GlutaMAX 2 mM (Gibco, 35050061) y 1000 U ml -1 de penicilina / estreptomicina (Gibco, 15140122). THP1, H1299, H1975, H1437, H2052, H2452, H520, H1915, NB-19, BEAS2B y H1395 se mantuvieron en el medio Roswell Park Memorial Institute 1640 (RPMI) complementado con 2 mM GlutaMAX (61870044, Gibco), 10% FBS ( Hyclone, South American Origin, SV30160.03, GE Healthcare) y 1000 U ml −1 de penicilina / estreptomicina (Gibco, 15140122). MCF 10A se mantuvo en medio de águilas modificado de Dulbecco / mezcla de nutrientes F-12 Ham (D6421, Sigma Aldrich), suplementado con suero de caballo al 10% (16050130, ThermoFisher), 10 µg ml -1 de insulina (I9278, Sigma Aldrich), 0,5 µg ml -1 de hidrocortisona (H0888, Sigma Aldrich), 20 ng ml -1 de factor de crecimiento epidérmico humano (hEGF: E9644, Sigma Aldrich) y 1000 U ml -1 de penicilina / estreptomicina (Gibco, 15140122). Se preparó una solución madre de 1 mg ml -1 de hidrocortisona en etanol y se preparó una solución madre de 100 µg ml -1 de hEGF en agua. Ambos se almacenaron en alícuotas a -20 ° C. Las células se mantuvieron en una confluencia de menos del 70% y las poblaciones no se pasaron más de 10 veces antes de cualquier experimento. En la figura 2mi, donde las células hTERT-RPE-1 se cultivan en RPMI, las células se cultivaron originalmente a partir del stock congelado en DMEM, se pasaron dos veces en RPMI y luego se sembraron en RPMI al comienzo del experimento.

2.2. Tratamiento de drogas

Palbociclib (PD-0332991), abemaciclib (LY2835219) y ribociclib (LEE011) se compraron a Selleck (números de catálogo S1116, S5716 y S7440, respectivamente), mientras que la timidina (T1895) y el nocodazol (M1404) fueron de Sigma-Aldrich. Se disolvieron palbociclib, abemaciclib, ribociclib y nocodazol en DMSO para generar soluciones madre de 10 mM en cada caso. Se disolvió timidina en agua para preparar una solución madre de 100 mM. Todas las reservas se almacenaron en alícuotas a -20 ° C.

Para las líneas celulares adherentes, las células se liberaron del sustrato mediante tratamiento con tripsina (15400054, Gibco), se sedimentaron mediante centrifugación a 300ºC.gramo durante 5 min antes de la resuspensión en medio de crecimiento. Las células se contaron usando un contador de células automático TC20 (BioRad) y se sembraron en placas 2,5 x 105 células en una placa de 10 cm (353003, Falcon) con 10 ml de medio (densidad de placa = 4,4 x 103 por cm 2). Para la línea de suspensión THP1, las células se sedimentaron mediante centrifugación a 300ºC.gramo durante 5 min, se resuspendieron en medio de crecimiento y se contaron, antes de sembrar 1 x 106 células en 10 ml de medio en una placa de 10 cm. A continuación, las células se incubaron durante 6 o 12 h (véanse las leyendas de las figuras) antes de añadir el fármaco.

2.3. Citometría de flujo

Para el análisis del ciclo celular, las células se lavaron una vez con solución salina tamponada con fosfato (PBS) antes de liberarlas del sustrato con tripsina, y se lavaron en PBS antes de fijarlas en etanol al 70% helado y congelar a -20 ° C durante al menos 18 h. hasta un máximo de dos semanas. Las células fijadas se sedimentaron, se lavaron tres veces en PBS a temperatura ambiente antes de que se añadieran 50 µl 100 µg ml -1 de ARNasa (NB-03-0161, Generon) al sedimento final, seguido de 500 µl 50 µg ml -1 de yoduro de propidio ( P4170, Sigma-Aldrich) disuelto en PBS. Las muestras se analizaron dentro de una ventana de entre 30 min y 6 h después de la adición de yoduro de propidio. Los datos se adquirieron en un citómetro de flujo BD LSR II (BD Biosciences) utilizando el software FACSDiva ™ (BD Biosciences) y se analizaron con el software FlowJo (BD Biosciences). Se contó un total de 1 x 104 células para cada muestra.

El estado de la fase S se controló midiendo la incorporación de 5-etinil-2'-desoxiuridina (EdU) con el kit de ensayo de citometría de flujo Click-iT ™ Plus EdU Alexa Fluor 488 (ThermoFisher, C10632) de acuerdo con las instrucciones del fabricante. Para monitorear el contenido de ADN acumulado entre el momento de la liberación y el punto de fijación en la figura 9C, Se añadió 1 µM de EdU en el momento de la liberación de palbociclib. Las células se tripsinizaron y lavaron con 3 ml de BSA al 1% en PBS, luego se incubaron con 100 µl de fijador Click-iT ™ durante 15 min, se sedimentaron, se lavaron con 3 ml de BSA al 1% en PBS y se dejaron a 4ºC durante la noche. Las células se resuspendieron en 100 µl de reactivo de permeabilización y lavado 1 × Click-iT ™ y se incubaron con 500 µl de cóctel de reacción Click-iT ™ Plus durante 30 minutos, antes de lavar una vez con 3 ml de permeabilización y lavado 1 × Click-iT ™ reactivo y resuspendido en 500 µl de 1 × reactivo de permeabilización y lavado Click-iT ™. Se añadió colorante FxCycle Violet (F10347, Invitrogen) hasta una concentración final de 1 µg ml -1. Las muestras se analizaron en un citómetro de flujo BD LSR II (BD Biosciences) utilizando el software FACSDiva (BD Biosciences) y se analizaron con el software FlowJo (BD Biosciences). Se contó un total de 104 células por muestra. Para la cuantificación, se usó el pico de células 2 N para evaluar el contenido de ADN 2 N, ya que la superposición entre la fase S y G2 / M dificultaba la asignación categórica del estado del ciclo celular en función del contenido de ADN 4 N solo. Por lo tanto, a lo largo del manuscrito, monitoreamos la progresión del ciclo celular como una reducción en el contenido de ADN 2 N.

2.4. Inmunofluorescencia

Las células se cultivaron en cubreobjetos de 13 mm (nº 1.5, VWR, 631-0150P) en placas de 10 cm (353003, Falcon) usando las condiciones de crecimiento apropiadas. Para la tinción con EdU, se utilizó el kit de proliferación celular Click-iT ™ EdU para la obtención de imágenes, colorante Alexa Fluor ™ 594 (Invitrogen, C10339). Una hora antes de recolectar las células, se añadió EdU 10 µM al medio de cultivo. Las células se lavaron en PBS antes de fijarlas durante 20 min en paraformaldehído al 2% en PBS, antes de tres lavados en PBS + Tween al 0,1% y el almacenamiento en PBS + Tween al 0,1% a 4ºC durante la noche. La permeabilización en PBS + Triton-X-100 al 0,5% fue seguida por tres lavados en PBS + Tween al 0,1%. La reacción Click-iT ™ para la detección de EdU se realizó de acuerdo con las instrucciones del fabricante. Las células se lavaron tres veces en albúmina de suero bovino al 5% (BSA ThermoFisher Scientific, 11423164) en PBS y luego se incubaron con anticuerpo primario para H2AX (Ser139), clon JBW301 (Millipore Cat no. 05-636, RRID: AB_309864) a una dilución de 1 en 500 durante 1 h antes de tres lavados en PBS + 5% de BSA e incubación con una dilución 1 en 500 de anticuerpo de cabra anti-ratón IgG Alexafluor 488 (Thermo Fisher Scientific Cat no. A32723, RRID: AB_2633275), y 2 mg ml −1 4 ', 6-diamidino-2-fenilindol (DAPI, ThermoFisher Scientific, 11916621) durante 1 h. Después de otros tres lavados en PBS + Tween al 0,1%, los cubreobjetos se montaron por inversión sobre 2 µl de medio de montaje Vectashield Antifade Mounting Medium (Vector Labs H1000). Los portaobjetos se analizaron usando un microscopio Axioskop2 (Zeiss, Inc.).

2.5. Análisis de proteínas

Para recolectar muestras de proteína hTERT-RPE1, se retiró el medio de cultivo, por aspiración, de una placa de 10 cm, antes de dos lavados en PBS y la adición de 400 µl de tampón de muestra TruPAGE LDS (Sigma-Aldrich, PCG-3009) que contenía un cóctel completo de inhibidor de proteasa. (Roche, 11697498001), PhoSTOP (Sigma-Aldrich, 4906837001) y DTT Sampler Reducer (Sigma-Aldrich, PGC-3005) a la placa. Se rasparon las células de la placa para transferirlas a un tubo de microcentrífuga de 1,5 ml y se congelaron instantáneamente en nitrógeno líquido para almacenarlas a -80ºC. Para THP1, las células se centrifugaron a 300gramo durante 3 min y el sedimento se resuspendió en tampón de muestra como se indicó anteriormente, se congeló en nitrógeno líquido y se almacenó a -80 ° C. Las muestras se calentaron a 70 ° C durante 10 min antes de cargarlas en un gel TruPAGE prefabricado de 10 cm al 10% (Sigma-Aldrich PCG2009) con tampón de ejecución TruPAGE SDS (Sigma Aldrich PCG3001) y se transfirieron a una membrana de PVDF (BioRad, 1620177) por transferencia húmeda con tampón de transferencia TruPAGE (Sigma-Aldrich PCG3011). Las membranas se bloquearon en leche al 5% y se incubaron en BSA al 2% con anticuerpos primarios contra GAPDH (Cell Signalling Technology Cat n. ° 13084, RRID: AB_2713924), Eg5 (Sigma Aldrich Cat n. ° SAB4501650, RRID: AB_10747045), Wee1 (Cell Signalling Technologies Cat no. 13084, RRID: AB_2713924) o pHH3 ser10 (anticuerpo personalizado contra el péptido ARTKQTARKS * TGGKAPRKQLASK: Eurogentec) durante la noche a 4 ° C. Después del lavado, las membranas se incubaron durante 1 ha temperatura ambiente, con el anticuerpo secundario apropiado (anticuerpo conjugado con fosfatasa IgG anti-ratón (Sigma-Aldrich nº de cat. A3688, RRID: AB_258106) o anticuerpo conjugado con fosfatasa IgG anti-conejo (Sigma-Aldrich Cat # A3687, RRID: AB_258103)), lavado y revelado con fosfato cromogénico de 5-bromo-4-cloro-3-indolilo (BCIP, Sigma-Aldrich, B6149).

3. Resultados

3.1. Sincronización eficiente de la progresión del ciclo celular de hTERT-RPE1 con tratamiento transitorio con palbociclib

La línea celular hTERT-RPE1 inmortalizada con telomerasa se usa ampliamente para estudios mitóticos y del ciclo celular, pero es refractaria a la sincronización de inducción de bloque de timidina doble. Por lo tanto, elegimos esta línea popular para evaluar la eficiencia de la detención y liberación de G1 por exposición transitoria a palbociclib.

Las células se cultivaron hasta 1,5 x 104 células cm-2 en medio de águilas modificado de Dulbecco (10%) suplementado con suero (DMEM), antes de liberarlas del sustrato con tripsina y sembrar en placas a una densidad de 4,4 x 103 células por cm 2. Seis horas más tarde, se añadió palbociclib en un intervalo de concentraciones de 50 nM a 1 µM a dos poblaciones idénticas. Veinticuatro horas más tarde, se fijó una población, mientras que el medio que contenía palbociclib para la otra se reemplazó por medio precalentado que contenía nocodazol 330 nM, antes de que esta muestra se fijara 24 h más. La evaluación del contenido de ADN mediante el análisis de clasificación de células activadas por fluorescencia (FACS) de muestras teñidas con yoduro de propidio (PI) reveló una detención estricta en el punto de tiempo de 24 h con contenido de ADN 2 N en todas las concentraciones de palbociclib de 100 nM y superiores (figura 1a, b). Las células se liberaron fácilmente en una detención de 4 N después de ser detenidas en G1 durante 24 h con palbociclib 100 nM y 200 nM; sin embargo, la liberación fue menos eficiente cuando la detención fue impuesta por palbociclib 500 nM y 1 µM (figura 1B) ya que el contenido de ADN 2 N permaneció alto 24 h después de la adición de nocodazol.

Figura 1. Sincronía de inducción de palbociclib de células hTERT-RPE1. (a) Se cultivaron células hTERT-RPE1 hasta 1,5 x 104 células cm2 en DMEM (+ suero al 10%), se tripsinizaron y se sembraron en placas de 10 cm a 4,4 x 103 cm −2. Seis horas más tarde, se añadió palbociclib 150 nM al cultivo. Después de 24 h, las células se lavaron dos veces con medio precalentado antes de la adición de medio precalentado que contenía nocodazol 330 nM antes de la incubación durante 24 h más. Las muestras (un plato de 10 cm por punto de datos) se tiñeron para el análisis FACS de yoduro de propidio en los siguientes puntos de tiempo: justo antes de la adición de palbociclib (U, sin tratar), en el cambio de palcociclib a medio de nocodazol (P) y 24 h después de este cambio a nocodazol (P + N). La fuerza de la detención del punto de control del huso inducida por nocodazol se reveló mediante la adición de nocodazol a una población asincrónica (U + N) durante 24 h. El pico bimodal en el panel superior (U) muestra 2 N (G1, izquierda) ADN y 4 N (G2 / M, derecha) contenido de ADN de una población asincrónica no tratada. Este experimento se repitió seis veces. (B) Las poblaciones de células se trataron de la misma forma que (a) con la concentración de palbociclib cambiada al valor indicado y una muestra sin tratar. La frecuencia media de 2 N células de al menos tres repeticiones biológicas se representa para los puntos de detención de palbociclib (barras grises) y nocodazol (barras azules). Las barras de error muestran los límites de 1 s.d .. (C,D) Se cultivaron células hTERT-RPE1 hasta aproximadamente 1,5 x 104 células cm −2 en DMEM (+ 10% de suero), se tripsinizaron y se sembraron en placas de 10 cm a 4,4 x 103 cm −2. Doce horas más tarde, se añadió palbociclib 150 nM al cultivo, antes de tres lavados en DMEM precalentado y de tomar muestras de un plato cada hora para generar los perfiles FACS de yoduro de propidio en (C) a partir de la cual las parcelas de contenido de 2 N que se muestran en (D) se derivaron. Los números junto a las parcelas en C indique el tiempo (horas) desde la liberación con U indicando una población de control no tratada. Los gráficos de 13 a 25 h (rojo (C): cuadrados abiertos (D)) se tomaron simultáneamente junto con la población de 0-12 h (gris (C): círculos rellenos (D)). La sincronización que se muestra en (C,D) se ha realizado seis veces y siempre revela resultados comparables; sin embargo, las variaciones en los perfiles de sincronización precisos en cada experimento (como se puede ver en las siguientes figuras del manuscrito) significan que no es apropiado fusionarlos en un solo conjunto de datos.

El control del contenido de ADN a intervalos de una hora después de la liberación de la detención de palbociclib 150 nM reveló una progresión sincrónica desde la detención de G1 con ADN 2 N, a través de la fase S en fases G2 / M con contenido de ADN 4 N antes de un retorno a ADN 2 N a las 20 h (figura 1C,D). Al igual que con todos los experimentos presentados en este documento, se cubrieron períodos de 24 o 48 h muestreando poblaciones paralelas indicadas por líneas / sombreados negros y rojos en los gráficos FACS y círculos y cuadrados en los gráficos. Por ejemplo, en las muestras de 0 a 13 h de un experimento de 24 h, se eliminó palbociclib al comienzo del muestreo, mientras que la liberación se había realizado 13 h antes para las muestras que se recolectaron simultáneamente para las muestras de 13 a 24 h. En consecuencia, muchos gráficos que presentamos tienen puntos de tiempo de 13 h de cada conjunto.

Como el segundo ciclo después de la liberación es menos probable que se vea influenciado por los desafíos fisiológicos de la sincronía de inducción, a menudo es deseable monitorear este segundo ciclo, en lugar del primer ciclo después de la liberación [1]. Por lo tanto, ampliamos nuestras evaluaciones para controlar el contenido total de ADN durante 48 h después de la liberación del tratamiento de 24 h con palbociclib 150 nM. Un notable grado de sincronía persistió en el segundo ciclo con 2 N células declinando para constituir el 46% de la población 30 h después de la liberación (figura 2a material complementario electrónico, figura S1). Por lo tanto, será posible monitorear algunas tendencias en el comportamiento bioquímico asociado con la progresión del ciclo celular en el segundo ciclo después de la liberación.

Figura 2. Contexto y duración de la sincronización de inducción de palbociclib. Para (a), se cultivaron células hTERT-RPE1 hasta aproximadamente 1,5 x 104 células cm −2 en DMEM (+ 10% de suero), se tripsinizaron y se sembraron en placas de 10 cm a 4,4 x 103 cm −2. Doce horas más tarde, se añadió palbociclib 150 nM. Veinticuatro horas después de la adición de palbociclib, las células se lavaron dos veces con medio que no contenía palbociclib antes de la incubación en DMEM precalentado (+ 10% de suero) con muestreo de una placa cada 2 h para tinción FACS de yoduro de propidio para generar los perfiles en Lotes de 12 h que cubren un período de liberación de 48 h de la misma población de células. Las muestras para 0-12 (círculos rellenos), 14-24 (cuadrados abiertos), 26-36 (círculos rellenos) y 36-48 (cuadrados abiertos) se tomaron en paralelo de subpoblaciones a las que se les había añadido palbociclib a intervalos escalonados. . Este experimento se realizó dos veces, con resultados similares en cada iteración. (Bmi) Gráficos derivados de la misma población de células. Para (B), se cultivaron células hTERT-RPE1 hasta 1,5 x 104 células cm −2 en DMEM (+ 10% de suero), se tripsinizaron y se sembraron en placas de 10 cm a 4,4 x 103 cm −2. Doce horas más tarde, se añadió palbociclib 150 nM. Veinticuatro horas después de la adición del fármaco, las células se lavaron dos veces con medio antes de la incubación en DMEM precalentado (+ 10% de suero) que carecía de palbociclib y se siguieron dos lotes de la misma población de células hTERT-RPE1, tomando una muestra de 10 cm. plato para cada punto de datos. En un lote (símbolos abiertos), se volvió a agregar palbociclib 150 nM a la población 12 h después de la liberación inicial de palbociclib, mientras que el otro se dejó pasar el punto de restricción al segundo ciclo (rojo). Para (C), la densidad a la que las células de la misma población se utilizaron para la siembra inicial en (B y D) se sembraron en placas a una densidad cuatro veces mayor de 1,76 x 104 células cm -2 en placas de 10 cm. (D) La expansión de la misma población inicial utilizada en (B) y (C) carecía de un ciclo de división de modo que la población inicial que estaba sincronizada en (D) habían crecido hasta la confluencia (inhibición por contacto temprano) antes de sembrar en placas 12 h antes de la adición de palbociclib. (mi) Células de los mismos viales utilizados para sembrar las poblaciones utilizadas en BD se cultivaron en RPMI durante dos pases, junto con las células utilizadas en BD, antes de toda la sincronización descrita en la figura 1C se realizó en RPMI. Para (Bmi), se tomaron muestras simultáneamente de dos lotes de la misma población: se agregó palbociclib a uno al inicio de un período de muestreo de 12 h (círculos), mientras que se agregó al otro 12 h antes (cuadrados). Para los gráficos FACS de los que se derivaron estos contenidos de ADN 2 N, consulte el material complementario electrónico, figuras S1 y S2.

Al estudiar los eventos al final del ciclo, las células de ciclo más rápido de la población avanzarán hacia el siguiente ciclo celular para iniciar una segunda ronda de eventos del ciclo celular antes de que los eventos del primer ciclo terminen por completo en algunos miembros de la población. Esta variación natural y sutil en el tiempo de progresión del ciclo celular genera un conjunto de datos fusionado, en el que la información de los segundos ciclos de algunas células se superpone a la de las células que aún se acercan al final de su primer ciclo. De esta manera, los puntos más finos de la cinética del cambio en el primer ciclo pueden oscurecerse por eventos superpuestos en el ciclo siguiente. Una solución simple para superar esta confusión sería asegurarse de que se bloqueara la salida del primer ciclo. Esto se puede lograr fácilmente mediante la re-adición de palbociclib a la mitad del primer ciclo celular. Por lo tanto, preguntamos si tal re-adición de palbociclib, después de la liberación de la primera detención, comprometería la progresión a través del ciclo observado. Es alentador que una segunda aplicación de inhibidor de Cdk4 / 6 12 h después de la liberación no tuvo ningún impacto en la progresión a través del ciclo en estudio (figura 2B), compare los símbolos rojo (sin re-adición) y negro abierto (palbociclib agregado nuevamente a las 12 h: material complementario electrónico, figura S2a, b). Por tanto, la re-adición de palbociclib se puede utilizar para aislar las observaciones de las consecuencias de la entrada en el siguiente ciclo, dando así una mayor comprensión de la cinética de los eventos del ciclo celular.

3.2. Las condiciones de crecimiento son clave para una sincronización óptima

El impacto del metabolismo, el control del crecimiento y la inactividad sobre el control del compromiso con el ciclo celular nos llevó a evaluar el impacto del contexto sobre la eficiencia de la sincronización de inducción de palbociclib de las células hTERT-RPE1. Hubo una reducción notable en la eficiencia de sincronización de las células hTERT-RPE1 cuando la densidad de la población sembrada en plástico 6 h antes de la adición de palbociclib se cuadruplicó a 1,76 x 104 células cm -2. A esta densidad, la proporción de la población con un contenido de ADN de 2 N solo se redujo al 38% en lugar de la caída al 16% en la población idéntica sembrada a 4,4 × 10 3 cm −2 (figura 2C material complementario electrónico, figura S2c). La eficiencia tanto del arresto como de la liberación también se vio comprometida cuando la población idéntica utilizada en la figura 2B,C había crecido hasta la confluencia para inducir "inhibición por contacto" antes de dividirse para generar las poblaciones que fueron detenidas para la sincronización (disminuyó a solo 23% 2 N, figura 2D material complementario electrónico, figura S2d). Finalmente, en estudios simultáneos de células de la misma población inicial que habían sido pasadas dos veces en Roswell Park Memorial Institute 1640 Medium (RPMI) antes de la sincronización en este medio, menos células detuvieron la progresión del ciclo celular después de 24 h en Palbociclib (81% versus 95%) y la proporción de 2 N células solo bajó al 37% de la población en RPMI, en lugar de la disminución al 16% en DMEM (figura 2B,mi material complementario electrónico, figura S2a, e). Por lo tanto, las condiciones de cultivo alteran la eficiencia de la sincronización y, una vez que los estudios iniciales indican que una línea es competente para la sincronización, se deben evaluar una variedad de condiciones y se debe tener cuidado para asegurar que las células permanezcan dentro de la proliferación activa en la expansión en el período previo. a la sincronización.

3.3.Las oscilaciones en los marcadores establecidos del ciclo celular acompañan la progresión a través de ciclos sincronizados

Para evaluar la utilidad del enfoque para los ensayos bioquímicos, se probaron extractos de un cultivo sincronizado con palbociclib con anticuerpos para controlar los marcadores cuyos niveles fluctúan a medida que las células transitan los ciclos sincronizados por otros medios. Las fluctuaciones anticipadas en los niveles de la quinesina 5 Eg5 y la fosforilación en la serina 10 de la histona H3 resaltan la utilidad de este enfoque para monitorear los cambios bioquímicos en toda la población (figura 3).

Figura 3. La sincronía de inducción de Cdk4 / 6 puede revelar eventos transitorios del ciclo celular. Se cultivaron células hTERT-RPE1 hasta aproximadamente 1,5 x 104 células cm −2 en DMEM (+ 10% de suero), se tripsinizaron y se sembraron en placas a 4,4 x 103 cm −2 en placas de 10 cm. Doce horas más tarde, se añadió palbociclib 150 nM. Veinticuatro horas después de la adición de palbociclib, las células se lavaron dos veces en medio de crecimiento antes de reemplazar el medio con DMEM precalentado (+ suero al 10%) que no contenía nada de palbociclib. Se tomó un plato de 10 cm por cada muestra cada hora para generar los perfiles FACS de yoduro de propidio en lotes de 13 h (a) para medir las fluctuaciones en el contenido de ADN 2 N en la población (B), mientras se tomaba muestras para monitorear los marcadores indicados por western blot cada 2 h (C). Los números junto a las parcelas en (a) indican las horas desde la liberación con U indicando una población de control sin tratar. Tanto la proteína motora Eg5 de la quinesina 5 mitótica como la fosforilación de la serina de la histona H3 en el pico de la posición 10 cuando las células regresan del estado 4 N al estado 2 N (mitosis y división celular). Este gráfico muestra uno de los tres experimentos repetidos, que revelaron fluctuaciones similares en los mismos marcadores del ciclo celular.

3.4. Sincronización de múltiples líneas con palbociclib, ribociclib y abemaciclib

A continuación, preguntamos si la sincronización de inducción de palbociclib sería igualmente eficaz en otras líneas mediante la evaluación de la eficacia de la detención y posterior liberación en nocodazol de otras 24 líneas celulares después de la adición de un rango de concentraciones de palbociclib durante 24 h seguido de reemplazo con medio de nocodazol 330 nM. e incubación durante 24 h más. Estos experimentos fueron de naturaleza exploratoria y, por lo tanto, no se realizaron con el mismo grado de rigor que los estudios de hTERT-RPE1 o los análisis detallados de A549, H1299 y THP-1 descritos en otra parte de este manuscrito. Específicamente, para algunas líneas, se contaron menos de 10 000 células y solo se realizaron dos repeticiones biológicas (cada una con dos repeticiones técnicas). Estas investigaciones exploratorias no revelaron un impacto apreciable de palbociblib sobre la progresión del ciclo celular en 7 de las 24 líneas (figura 4), respuestas parciales en 9, con perfiles de detención y liberación explotables observados en 8: MCF10A, LoVo, H1975, NB19, DLD1 (figura 5), THP-1, H1299 y A549. La liberación de detención robusta en el H1299, A549 y THP-1 se confirmó en pruebas más rigurosas de al menos tres repeticiones biológicas, más de 10 000 recuentos de células (figura 6).

Figura 4. Detección de sincronización por inducción de palbociclib: líneas celulares refractarias. Las líneas celulares indicadas se cultivaron hasta aproximadamente 1,5 x 104 células cm −2 en el medio especificado en los métodos, se tripsinizaron y se sembraron en placas de 10 cm a 4,4 x 103 cm −2. Seis horas después, las células se trataron con la concentración indicada de palbociclib o se dejaron sin tratar. Veinticuatro horas después de esto, las muestras se tiñeron para el análisis FACS de yoduro de propidio para medir la proporción de la población que tenía un contenido de ADN de 2 N. Se utilizó un plato de 10 cm para cada conjunto de datos. Cada gráfico representa el promedio de un mínimo de cuatro conjuntos de datos (al menos dos repeticiones biológicas, cada una de las cuales tenía al menos dos repeticiones técnicas). Las barras de error representan 1 × s.d.

Figura 5. Detección de sincronización por inducción de palbociclib: líneas celulares sensibles. Cada línea se cultivó en el medio especificado en los métodos hasta aproximadamente 1,5 x 104 células cm −2 tripsinizadas y se sembró en placas a 4,4 x 103 cm −2 en placas de 10 cm. Seis horas más tarde, se añadió palbociclib 0,2 o 1 µM a un tercio de las placas para cada población celular. Se dejó sin tratar una muestra de control. Veinticuatro horas después de esto, las células se fijaron para tinción (barras grises) o se lavaron con medio fresco dos veces antes de la incubación en nocodazol 330 nM durante 24 horas, después de lo cual estas muestras se fijaron y procesaron para el análisis de FAC de yoduro de propidio junto con las muestras que tenían corregido 24 h antes (barras azules). La proporción de la población que tenía un contenido de ADN de 2 N se calculó a partir de los perfiles de FAC y se representó en los paneles. Las muestras de las primeras 24 h de incubación se muestran en gris, mientras que las muestras posteriores tratadas con nocodazol se muestran en azul. Cada gráfico representa el promedio de al menos cuatro conjuntos de datos (al menos dos repeticiones biológicas, cada una de las cuales tenía al menos dos repeticiones técnicas). Las barras de error representan 1 × s.d. Estas pruebas experimentales fueron de naturaleza puramente exploratoria con el objetivo de encontrar líneas para un análisis más detallado en el resto del estudio. Por lo tanto, estos datos no deben utilizarse para descartar la posibilidad de sincronización de Cdk4 / 6i en las líneas celulares que muestran una respuesta parcial. No hemos probado diferentes inhibidores, medios, incubaciones más largas (en caso de que los ciclos celulares de ciertas líneas emulen el de THP-1 de más de 24 h), o si la adición de un inhibidor de MAP quinasa o Cdk6 PROTAC puede agudizar las respuestas. . Consulte Discusión para obtener más detalles.

Figura 6. Espectro de respuestas de cuatro líneas diferentes a tres inhibidores de Cdk4 / 6. Se cultivaron THP1 y H1299 en RPMI (+ 10% de suero) y hTERT-RPE1 y A549 se cultivaron en DMEM (+ 10% de suero). Cada línea adherente se cultivó hasta aproximadamente 1,5 x 104 células cm-2 antes de que se tripsinizaran y se colocaran en placas a 4,4x103 cm-2 en placas de 10 cm. Las células de THP1 en suspensión se cultivaron hasta aproximadamente 4 x 105 ml -1, se centrifugaron a 300ºC.gramo durante 3 min antes de colocar en placas a 1 × 10 5 ml −1 en platos de 10 cm. Se sembró una placa de 10 cm para cada condición. Seis horas más tarde, se añadió a cada población la concentración indicada del inhibidor de Cdk4 / 6 indicado. Veinticuatro horas después de esto, las muestras (un plato completo de 10 cm) se fijaron o lavaron con medio fresco dos veces antes de la incubación en medios que contenían nocodazol 330 nM durante 24 h, después de lo cual estas muestras se fijaron y procesaron para el análisis de FAC de yoduro de propidio junto con el muestras que se habían fijado 24 h antes (barras azules). La proporción de la población que tenía un contenido de ADN de 2 N se calculó a partir de los perfiles de FAC y se representó en los paneles. Las muestras de las primeras 24 h de incubación se muestran en gris, mientras que los perfiles de detención de nocodazol posteriores en azul. Cada gráfico representa el promedio de al menos tres repeticiones biológicas. Las barras de error representan 1 × s.d.

Como los diferentes inhibidores de Cdk4 / 6 exhiben distintas respuestas farmacológicas [68], comparamos los perfiles de sincronización de inducción en cuatro líneas diferentes para medir el espectro de respuestas y si la dependencia del palbociclib solo como medio para juzgar la competencia para la sincronía de inducción de la inhibición de CDK4 / 6 fue un enfoque válido, o si otros inhibidores pueden mostrar una eficacia aún mayor. Las poblaciones de A549, H1299, THP1 y hTERT-RPE1 se expusieron a un intervalo de concentraciones de palbociclib, ribociclib y abembaciclib, antes de que el medio que contenía el fármaco CDK4 / 6 se cambiara por medio que contenía nocodazol 24 h después de la detención. Estas cohortes que contienen nocodazol se recolectaron luego 24 h después del intercambio en nocodazol (figura 6).

De acuerdo con la eficacia de palbociclib, estas líneas seleccionadas mostraron una fuerte sincronía de inducción del inhibidor de Cdk4 / 6 con los otros dos inhibidores (figura 6). Palbociclib y ribociclib dieron perfiles de detención / liberación excelentes y comparables en una amplia gama de concentraciones. Por el contrario, la ventana de competencia fue mucho más estrecha para abemaciclib (figura 6). Cuando se usa la eficacia de la detención de G1 para identificar concentraciones de fármaco que tienen un impacto comparable sobre el paso del punto de restricción, la capacidad de salir de la detención de G1 hacia el bloque G2 era marcadamente menor cuando la inhibición había sido impuesta por abemaciclib. Por ejemplo, para las células hTERT-RPE1, se requiere abemaciclib 200 nM para lograr el mismo bloqueo en G1 que palbociclib 100 nM, sin embargo, hubo una gran variación en la capacidad de liberación y un promedio del 57% de la población permaneció detenida con 2N, en lugar del 15% que persiste en la población tratada con palbociclib (figuras 1B y 6D). Esta ineficiencia es un tema recurrente en todas las líneas (figura 6C.A). Las comparaciones entre palbociclib y ribociclib revelan sutiles distinciones que sugieren que, cuando se va a realizar un trabajo extenso con una línea específica, sería conveniente probar ambos inhibidores al ajustar el perfil de dosis-respuesta.

La línea THP-1 derivada de la leucemia mieloide aguda es una línea atractiva para los estudios del ciclo celular porque la recuperación celular a través de la sedimentación evita los desafíos de la recolección a partir de la adherencia a una matriz. Por lo tanto, evaluamos tanto la robustez de la sincronía en esta línea (figura 7a,C, D material complementario electrónico, figura S3) y el comportamiento de los marcadores del ciclo celular de firma a medida que una población transitaba por un cultivo sincronizado (figura 7a,C). Como se observa para las células hTERT-RPE1 en la figura 3, los marcadores oscilaron con sus periodicidades características, todas a un ritmo más lento, en reflejo del primer ciclo celular más largo de 30 h de las células THP1 (figura 7).B compare este perfil con el primer ciclo de 22 h de células hTERT-RPE1, figura 2a).

Figura 7. Utilidad de la línea celular en suspensión THP1 para el análisis del ciclo celular. Las células THP1 se cultivaron hasta aproximadamente 4 x 105 células ml -1 en RPMI (+ 10% de suero), se aislaron mediante centrifugación suave a 300ºC.gramo durante 3 min, antes de la resuspensión en RPMI a una concentración de 1 x 105 células ml -1 en placas de 10 cm. Doce horas más tarde, se añadió palbociclib 150 nM durante 24 h antes de aislar las células mediante centrifugación a 300ºC.gramo durante 3 min y una vez más se resuspendió en RPMI. Se tomaron muestras (un plato de 10 cm por muestra) cada 2 h para generar los perfiles FACS de yoduro de propidio en lotes de 12 h (a) para medir las fluctuaciones en el contenido de ADN 2 N en la población (C), mientras se tomaba muestras para monitorear los marcadores indicados por western blot cada 2 h (B). Los números junto a las parcelas en (a) indican las horas desde la liberación con U indicando una población de control sin tratar. Este análisis de muestras de ciclo celular por transferencia Western que se muestra en aC se hizo tres veces. (D) Células cultivadas como en (a) con la excepción de que el muestreo de lotes de 12 h se extendió durante un período de liberación de 48 h de la misma población de células. Para este lote de células, las muestras solo se procesaron para el análisis de PI FAC del contenido de ADN para generar el gráfico de la frecuencia de 2 N células que se muestran en el panel. Las muestras para 0-12 (círculos rellenos), 14-24 (cuadrados abiertos), 24-36 (círculos rellenos) y 36-48 (cuadrados abiertos) se tomaron en paralelo de subpoblaciones a las que se les había añadido palbociclib a intervalos escalonados. . Los gráficos FAC de yoduro de propidio a partir de los cuales los datos en (D) se derivan de material complementario electrónico, figura S3. Este análisis de una progresión de 48 h de THP1 se realizó una vez. Tenga en cuenta que el tiempo que tardan las células THP1 en transitar el primer ciclo celular, en estas condiciones, es de 32 h.

3.5. Los cócteles de inhibidores igualan la eficacia de la sincronización de un solo agente

La inhibición fuera del objetivo es una preocupación para la interpretación de fenotipos que surgen de perturbaciones químicas. Con el objetivo de minimizar los impactos fuera del objetivo de cada inhibidor individual [68], preguntamos si un cóctel de los tres inhibidores sería tan eficaz como un solo agente. Usamos una mezcla de un tercio de la concentración más efectiva para cada fármaco individual para cada fármaco individual para cada línea celular (como se indica en la leyenda de la figura) para probar el nivel de detención y liberación del ciclo celular. Es alentador que todas las líneas ofrecieran una detención robusta y una liberación eficiente (figura 8).

Figura 8. Los cócteles apoyan la detención y liberación eficientes en cuatro líneas de respuesta. Se cultivaron THP1 y H1299 en RPMI (+ suero al 10%). Se cultivaron hTERT-RPE1 y A549 en DMEM (+ suero al 10%). Las líneas de células adherentes se cultivaron hasta aproximadamente 1,5 x 104 células cm-2 antes de que se tripsinizaran y se sembraran en placas a 4,4x103 cm-2 en placas de 10 cm. La línea de suspensión THP1 se cultivó hasta aproximadamente 4 x 10 5 ml -1 y se centrifugó a 300ºC.gramo durante 3 min antes de colocar en placas a 1 × 10 5 ml −1 en platos de 10 cm. Se sembraron cuatro placas de 10 cm para cada línea celular. Seis horas después, se dejaron dos platos para cada línea como control sin tratar, mientras que el cóctel indicado comprendía abemaciclib 33 nM + palbociclib 33 nM + ribociclib 300 nM para THP1 y H1299, abemaciclib 33 nM + palbociclib 33 nM + ribociclib 67 nM para A549 y se añadió al otro abemaciclib 33 nM + palbociclib 33 nM + ribociclib 167 nM para hTERT-RPE1. Veinticuatro horas más tarde, se fijó una placa para cada condición para la tinción, mientras que el medio en la placa restante se reemplazó con medio que contenía nocodazol 330 nM. El intercambio de medios para A549, H1299 y hTERT-RPE1 se logró mediante aspiración, mientras que el cambio de medios para THP1 se logró mediante centrifugación suave a 300ºC.gramo durante 3 min seguido de resuspensión en el medio que contiene nocodazol. Veinticuatro horas más tarde, estas tres muestras de nocodazol se fijaron y procesaron para el análisis de FAC de yoduro de propidio junto con las muestras que se habían fijado 24 h antes. La proporción de la población que tenía un contenido de ADN de 2 N se calculó a partir de los perfiles de FAC de yoduro de propidio y se representó en los paneles. Las muestras de detención del cóctel inhibidor de las primeras 24 h de incubación se muestran en gris, mientras que los perfiles de detención de nocodazol posteriores en azul. Las muestras tratadas con el cóctel inhibidor se indican con C, mientras que la población no tratada con U. Cada gráfico representa el promedio de al menos tres repeticiones biológicas. Las barras de error representan 1 × s.d.

3.6. La tinción de γ-H2AX revela un daño mínimo en el ADN en la sincronía de inducción de palbociclib

Una limitación importante del enfoque de "doble bloqueo de timidina" ampliamente utilizado es la acumulación de daño en el ADN durante la detención de la fase S temprana [28]. Es probable que este daño se deba al colapso y a los intentos de reparación de las bifurcaciones de replicación del ADN que se estancaron porque la provisión de nucleótidos se vio comprometida [27]. Es probable que el daño acumulado explique los perfiles anormales de anafase en las divisiones después de la liberación del bloqueo de timidina [29].

Por lo tanto, monitoreamos la acumulación de un marcador de roturas de doble cadena de ADN, focos de fosforilación de γ -H2AX en serina 139, para evaluar el nivel de daño durante la detención de palbociclib y el ciclo subsiguiente después de la liberación. Como estos focos se forman naturalmente durante la fase S, cuando las horquillas de replicación generan roturas de doble hebra, contrateñimos las células para identificar aquellas que experimentan la replicación del ADN en la hora anterior al muestreo agregando 10 µM del nucleótido 5-etinil-2'-desoxiuridina (EdU). 1 h antes de procesar cada muestra. Todas las células que se tiñen con este pulso de EdU de 10 µM habrán estado replicando activamente el ADN en la hora anterior a la fijación. Esto nos permitió distinguir las células positivas para EdU con focos de γ-H2AX, en las que asumimos que los focos son una consecuencia de la replicación del ADN, de aquellas sin tinción de EdU, en las que asumimos que los focos son indicativos de sitios de reparación del daño del ADN. . Contamos una célula como positiva para focos de γ-H2AX cuando la tinción de inmunofluorescencia reveló más de dos focos en un núcleo. Para consolidar el conocimiento sobre el momento de la fase S a partir de la evaluación del contenido total de ADN en toda la población (figura 9a,B), monitoreamos la progresión a través de la fase S cuantificando la incorporación acumulativa de EdU en el ADN después de la adición de la concentración más baja de 1 µM de EdU en el momento de la liberación para persistir durante todo el experimento y la etiqueta de todo el ADN sintetizado después de la liberación. La fase S se completó en gran parte a las 16 h después de la liberación de palbocilib 150 nM (figura 9C).

Figura 9. Focos de γ-H2AX asociados con la replicación del ADN en células hTERT-RPE1. Se cultivaron células hTERT-RPE1 hasta aproximadamente 1,5 x 104 células cm −2 en DMEM (+ suero al 10%), se tripsinizaron y se sembraron en placas a 4,4 x 103 cm −2 en placas de 10 cm. Se sembraron tres placas de 10 cm para cada punto de tiempo, una para la tinción de yoduro de propidio (a,B), uno para la incorporación acumulativa de EdU y otro con cubreobjetos para inmunofluorescencia. Doce horas más tarde, se añadió palbociclib 150 nM. Veinticuatro horas más tarde, las células se lavaron dos veces antes de la incubación en un medio precalentado que no contenía palbociclib. En este punto, un tercio de las placas se dejaron sin adición de EdU, se añadió 1 µM de EdU a un tercio de las placas en el momento de la liberación de la detención de palbociclib, para controlar la acumulación acumulativa de este marcador de la replicación del ADN (es decir, el grado de progresión de la fase S en cualquier punto dado). En las placas que contenían cubreobjetos, se añadió 10 µM de EdU a cada placa solo 1 h antes de que se fijaran estas muestras, para identificar las células que tenían muchas probabilidades de haberse replicado activamente en el momento de la fijación. Las células sin tratamiento con EdU se tiñeron con yoduro de propidio, para controlar el contenido de ADN (a) que se utilizó para calcular el valor de la proporción de la población con contenido de ADN 2 N (B), junto con la proporción de la población que había incorporado la EdU en un momento determinado (C). Las muestras de la población que había sido sometida a pulsos de 1 h 10 µM de EdU se tiñeron por contraste con anticuerpos γ-H2AX (D, mi). Los números junto a las parcelas en (a) indican horas desde la liberación, con U indicando una población de control no tratada. (D) Los gráficos muestran la frecuencia de las células con tinción de más de dos focos γ-H2AX (relleno ligero), EdU (relleno intermedio) o aquellas células positivas para ambos marcadores (negro). (mi) Se centra en las células positivas para γ-H2AX. Los gráficos muestran lo siguiente en los puntos de tiempo indicados después de la eliminación de palbociclib: la proporción de toda la población que se tiñe positiva para γ-H2AX solo (negro, es decir, células dañadas, que es poco probable que estén en fase S en el momento de la fijación), o para tanto γ-H2AX como EdU (gris, células en fase S en el momento de la fijación). Para cada punto de tiempo, se contaron al menos 200 células para puntuar cada característica como una proporción del total contado. Las dos poblaciones muestreadas en paralelo después de la adición escalonada de palbociclib se diferencian por gris y rojo en (a), círculos cerrados y cuadrados abiertos en (B,C).Este experimento se repitió tres veces con resultados similares cada vez; sin embargo, la cinética más fina de los gráficos de sincronía difirió, por lo que no fue apropiado combinar los conjuntos de datos.

Figura 9D muestra gráficos de una población de células hTERT-RPE1 sincronizadas mediante detención / liberación de palbociclib. Se indica la frecuencia de las células que incorporan el pulso EdU (sombreado gris oscuro), las que muestran más de 2 focos γ-H2AX (sombreado gris claro) y las que muestran tinción con ambos (negro). Para las parcelas de la figura 9mi, solo puntuamos las células que contenían focos de γ-H2AX. La porción de células de la población con focos, pero sin EdU, está sombreada en negro. Por el contrario, las células de la fase S de las células que se tiñeron positivas para la incorporación de EdU están representadas por un sombreado gris (figura 9mi).

Estos gráficos en la figura 9mi muestran que la gran mayoría de las células positivas para γ-H2AX son aquellas que están en proceso de replicar su ADN. Muy pocas células de la población tenían el marcador de daño en el ADN, pero ninguna tinción con EdU. Además, las células que acaban de iniciar la fase S pueden no haber incorporado niveles detectables del pulso de nucleótidos de EdU, aunque tendrán focos de γ-H2AX asociados con horquillas de replicación. En consecuencia, la evaluación mediante la puntuación de una incorporación positiva de la etiqueta de pulso EdU dará una modesta subestimación de las células de la fase S. Teniendo esto en cuenta, y el hecho de que muchas células que incorporaron el pulso EdU no tenían ningún γ -Focos de H2AX (figura 9D), parecería que un daño mínimo en el ADN acompaña a la sincronización de inducción de palbociclib (figura 9D,mi).

Como nuestros experimentos no publicados confirmaron la opinión ampliamente compartida de que las células hTERT-RPE1 son refractarias a la sincronización con la timidina (datos no mostrados), usamos H1299 para comparar directamente los niveles de daño en el ADN que surgen durante la sincronía de inducción de palbociclib y los que se acumulan en la detención del ciclo celular. y liberación tras la adición transitoria de timidina 2 mM a la misma población de partida (figura 10 material complementario electrónico, figura S4). Aunque el grado de sincronía logrado por la liberación de detención de palbociclib no es tan alto en H1299 como en hTERT-RPE1, los resultados fueron claros.

Figura 10. Daño del ADN en la detención y durante toda la liberación en células H1299 sincronizadas con timidina pero no con palbociclib. Las células H1299 se cultivaron hasta 1,5 x 104 células cm-2 en RPMI (+ suero al 10%), se tripsinizaron y se sembraron en placas a 4,4x103 cm-2 en placas de 10 cm. Doce horas después, palbociclib 150 nM (aC) o timidina 2 mM (DF) se añadió, como se indica. Se utilizaron dos placas de 10 cm para cada condición y cada punto de tiempo, una para el análisis FACS y otra que contenía cubreobjetos para inmunofluorescencia. Veinticuatro horas después de la adición del inhibidor, las células se lavaron dos veces con medio precalentado antes de la adición de medio precalentado que no contenía ningún inhibidor. Se extrajeron muestras (el contenido de un plato completo de 10 cm por muestra) para su fijación a intervalos de dos horas. Se agregaron diez EdU micromolares a cada plato que contenía cubreobjetos 1 h antes de la fijación, junto con el procesamiento para la tinción combinada de yoduro de propidio para monitorear el contenido de ADN por FAC (material complementario electrónico, figura S4) del cual derivamos las gráficas del contenido de ADN 2 N que se muestra en (a). El procesamiento de la tinción EdU reveló las células que probablemente estarían en la fase S en el momento de la fijación, mientras que la tinción γ-H2AX reveló células con roturas de doble hebra en su ADN nuclear que podrían surgir como consecuencia del daño del ADN o la replicación activa. . (B,mi) Gráficos de la frecuencia de células con tinción de más de dos focos γ-H2AX (relleno ligero), EdU (relleno intermedio) o aquellas células positivas para ambos marcadores (negro). (C,F) se centran únicamente en la población de células positivas para γ-H2AX. Se puntúan dos categorías: las que muestran solo una señal γ-H2AX y ninguna señal EdU (negro) y las positivas tanto para γ-H2AX como para EdU, por lo que es muy probable que estén en fase S en el momento de la fijación (luz). Para cada punto de tiempo, se contaron al menos 200 células para puntuar cada característica como una proporción del total contado. Las dos poblaciones muestreadas en paralelo después de la adición escalonada de palbociclib se diferencian por círculos cerrados y cuadrados abiertos en (a,D). Este experimento se repitió tres veces con resultados similares cada vez; sin embargo, la cinética más fina de los gráficos de sincronía difirió y, por lo tanto, no fue apropiado combinar los conjuntos de datos.

De acuerdo con informes anteriores [28], y en marcado contraste con los niveles mínimos de daño en el ADN con la sincronización de inducción de palbociclib (figura 10aC), la sincronización por exposición a una dosis única de timidina condujo a puntuaciones positivas para γ-H2AX persistentes para muchas células después de la liberación del punto de detención de la timidina en la fase S temprana (figura 10DF). Es importante destacar que había focos en muchas células que no habían incorporado la marca de pulso EdU de 1 h en el momento de la fijación (el sello distintivo de las células que se replican activamente) en las células mucho tiempo después de que se liberó el bloqueo (figura 10).mi,F). Estos datos sugieren que algunos daños que se acumularon en el punto de detención persistieron durante la liberación posterior, más allá del período de replicación. La persistencia del daño es consistente con informes previos de aberraciones cromosómicas durante las divisiones sincronizadas por la sincronía de inducción de timidina [29].

Aunque no podemos excluir formas de daño del ADN que no generan focos de γ-H2AX, la sincronización por inducción de palbociclib de la progresión del ciclo celular no parece comprometer la integridad del genoma en el mismo grado que la sincronización basada en timidina.

3.7. Competencia para la liberación mantenida durante 72 h

La eliminación, inducción o sustitución de una molécula de interés proporciona una gran comprensión de su función. Cuando la manipulación se realiza en cultivos sincronizados, es imperativo que la manipulación no ocurra en el ciclo anterior, de lo contrario, parte del fenotipo observado podría ser una consecuencia indirecta del daño irrelevante acumulado en el ciclo anterior a medida que las células se acercan al punto de bloqueo. Si bien es imposible evitarlo en la sincronización de selección, sigue siendo un desafío importante en muchas formas de sincronización de inducción que se basan en la detención. dentro de el ciclo. Uno de los principales atractivos de detener la progresión del ciclo celular en un punto en el que un ciclo está completo y el siguiente aún está por comenzar es que el impacto de cualquier manipulación molecular de la población detenida generará un fenotipo que es una consecuencia directa de esta manipulación en la progresión a través de el ciclo subsiguiente. Ninguna de las consecuencias será atribuible a problemas para completar el ciclo que conduce al bloque del que se liberan las células.

Por lo tanto, comparamos la competencia para volver al ciclo después de la inhibición de Cdk4 / 6 durante 24, 48 y 72 h. Los experimentos piloto establecieron que la capacidad de mantener la detención, o liberación tras detención, variaba entre líneas celulares, por lo que seleccionamos diferentes concentraciones de palbociclib para cuantificar rigurosamente la competencia para liberar después de una detención prolongada (figura 11). La eficiencia de la sincronización se evaluó mediante la adición de la concentración indicada de palbociclib a las células 6 h después de que se separaron de una población subconfluente y se incubaron durante los tiempos indicados antes de muestrear la mitad de la población para el análisis FAC del contenido de ADN (gris). El medio de crecimiento que contenía palbociclib para la otra mitad de la población se reemplazó con medio que contenía nocodazol 330 nM antes de que se tomaran muestras de esta población para el análisis de FAC 24 h más (azul). La incubación con nocodazol atrapó las células liberadas del bloque G1 en la siguiente mitosis como consecuencia de la activación del punto de control del ensamblaje del huso (SAC) [71]. Si bien la capacidad de mantener la detención de G1 disminuyó en diversos grados en las diferentes líneas, siendo hTERT-RPE1 la más competente para mantener la detención, todas las líneas salieron de la detención para reducir el número de células 2 N después de 24 h en nocodazol (figura 11 ).

Figura 11. Recuperación sustancial de la detención prolongada del ciclo celular impuesta por palbociclib. Se cultivaron THP1 y H1299 en RPMI (+ 10% de suero), y hTERT RPE1 y A549 se cultivaron en DMEM (+ 10% de suero). Las líneas adherentes se cultivaron hasta aproximadamente 1,5 x 104 células cm -2, se aislaron mediante digestión con tripsina y se sembraron en placas a 4,4x10 3 células cm -2 en placas de 10 cm. La línea celular en suspensión THP1 se cultivó hasta aproximadamente 4 x 105 células ml -1, se aisló por centrifugación a 300ºC.gramo durante 3 min y se colocan en placas a 1 x 105 ml −1 en placas de 10 cm. Se sembraron en placa dieciocho placas de 10 cm para cada línea celular. Seis horas más tarde, las placas se trataron con la concentración indicada de palbociclib o se dejaron sin tratar. En los intervalos de tiempo indicados, se procesó una placa para cada condición para el análisis de FAC de yoduro de propidio, mientras que otra se incubó en medio sin palbociclib que contenía nocodazol 330 nM durante 24 h más antes de que también se procesara para el análisis de FAC de yoduro de propidio. La proporción de la población que tenía un contenido de ADN de 2 N se calculó a partir de los perfiles de FAC y se representó en los paneles. Las muestras después de la incubación durante el tiempo que se muestra debajo del gráfico se muestran en gris, mientras que la muestra pareada de células de esta población que se habían liberado de la detención de palbociclib por reemplazo del medio con medio de nocodazol antes de la fijación 24 h después se muestran en azul. Cada gráfico representa el promedio de al menos tres repeticiones biológicas. Las barras de error representan 1 × s.d.

4. Discusión

Nuestro examen del potencial de la inhibición de Cdk4 / 6 como un enfoque novedoso para la sincronía de inducción revela un enfoque muy eficaz para la sincronización de la progresión del ciclo celular en una población de líneas celulares humanas adherentes o en suspensión. Creemos que una serie de atributos lo convierten en una valiosa adición a la amplia cartera de tecnologías de sincronización del ciclo celular.

La liberación de la detención del ciclo celular impuesta por palbociclib en el punto de decisión natural de las células, el punto de restricción, no se asocia con cambios en las tasas de crecimiento o tasas de progresión a lo largo del ciclo en el que se liberan [36,72]. Más bien, la actividad de Cdk4 / 6-Ciclina D parece establecer el control del tamaño [36,72]. Conceptualmente, esto resuena con la definición original del punto de restricción, como una pasarela de limitación de velocidad sobre la cual convergen múltiples sistemas reguladores para regular el paso a través de la pasarela hacia el compromiso de división [47].

Un segundo atractivo de este enfoque radica en el impacto aparentemente limitado sobre la integridad del genoma. Aunque el método de doble bloqueo de timidina ha predominado durante más de 50 años, el daño del ADN que acompaña a la detención persiste durante la liberación (figura 10) [28,29]. Este daño acumulativo limita la utilidad de este enfoque para el estudio en varios campos, incluida la replicación del ADN, la reparación del ADN y la cromatina. Si bien la evaluación de la integridad del genoma a través de la adquisición de focos de γ-H2AX no es una evaluación exhaustiva del daño, nuestros datos sugieren que la sincronía de inducción de Cdk4 / 6i no está acompañada por el daño que surge después de la liberación de timidina [29]. Los análisis exhaustivos de la progresión mitótica después de la sincronización de inducción de palbociclib no revelaron signos de ninguna de las anomalías cromosómicas que acompañan a la sincronización de inducción de timidina [73] (Jon Pines y Mark Jackman 2020, comunicación personal). La sincronización de inducción de Cdk4 / 6i, por lo tanto, tiene el potencial de abrir una serie de preguntas previamente intratables para estudiar en cultivos sincrónicos.

Quizás el atractivo más importante de este enfoque es que las células pueden permanecer detenidas fuera del ciclo celular en suero completo durante escalas de tiempo muy prolongadas mientras conservan la competencia para volver a un ciclo sincronizado. Esta estasis significa que una molécula de interés puede agotarse por completo, mientras que las células están fuera del ciclo, sin tener ningún impacto en la progresión a través del ciclo de división celular anterior. Si se indujera simultáneamente una versión mutante de este objetivo, apoyaría preguntas muy directas sobre la función de las proteínas cuando las células se liberan para transitar sincrónicamente el ciclo subsiguiente. El estudio de la regulación de la biogénesis de centriolos por Viol. et al. [70] proporciona una ilustración convincente del poder de la inducción de proteínas en una detención de palbociclib antes de su liberación.

Si bien los beneficios de este enfoque son particularmente atractivos, como ocurre con todos los enfoques de sincronización de ciclos, inevitablemente surgirán desventajas a medida que estos protocolos se adopten más ampliamente. Aunque parece que la acumulación de masa celular en el punto de detención no afecta la cinética del ciclo celular después de la liberación [36], los estudios en organismos modelo sugieren que es probable que haya una adaptación al control de tamaño modificado en algún momento después del compromiso [74]. Estudios recientes sugieren que es poco probable que se produzca la adaptación después del segundo ciclo después de la liberación [72]. El enfoque tampoco es eficaz en muchas líneas cuando el nivel de control ejercido por Cdk4 / 6 frente a Cdk2 se inclina más a favor del control de Cdk2 [13,20,22,48,54,61-63,72,75-79 ].

Cuando una línea en particular es refractaria a la sincronización de inducción de Cdk4 / 6, varios enfoques pueden cambiar la línea para conferir sensibilidad a la inhibición de Cdk4 / 6. Para las líneas en las que la inhibición de Cdk4 / 6 sola tiene poco impacto, reducir el flujo a Cdk4 / 6 Ciclina D al reducir el suero, o inhibir las vías de MAP quinasa aguas abajo puede comprometer la traducción para reducir los niveles de Ciclina D e inclinar la balanza para imponer la detención del ciclo celular por palbociclib, o inhibición de Cdk2 [13,59,72,80]. La detención del ciclo celular en HCT116 cuando trametinib complementa palbociclib es un buen ejemplo de esta sinergia [81]. La reciente revelación de que los inhibidores de Cdk4 / 6 se dirigen a los complejos Cdk4 y Cdk6 inactivos, en lugar de activos, sugiere otra opción para las líneas refractarias cuando la resistencia surge de una mayor dependencia de Cdk6, en lugar de Cdk4 [54]. Los inhibidores de Cdk4 / 6 imponen la detención porque secuestran Cdk4 y Cdk4-CyclinD lejos del sistema chaperona Hsp90 para reducir el número de moléculas que pueden formar un complejo activo con p27 [54,67,82]. La menor afinidad de Cdk6 por el complejo chaperona Hsp90 le permite ensamblar más fácilmente en trímeros activos que no tienen afinidad por los inhibidores que Cdk4. Esto ha llevado a la sugerencia de que el predominio de los trímeros Cdk6-Ciclina D-p27 agota la p27 de los grupos de Cdk2 para elevar las actividades de Cdk2 y conferir resistencia a palbociclib en cánceres en los que la expresión de Cdk6 es elevada [67,83,84]. Por lo tanto, las líneas celulares que dependen de Cdk6 en lugar de Cdk4 para impulsar el paso a través de la puerta de entrada al ciclo tendrán una sensibilidad reducida a los inhibidores de Cdk4 / 6. En tales líneas, un PROTAC específico de Cdk6 puede reducir la dependencia de Cdk6 para imponer sensibilidad a la inhibición de Cdk4 / 6 y así apoyar la sincronización con los inhibidores [85]. Por último, debido a que muchas líneas celulares evitarán el requisito de Cdk4 / 6 al explotar Cdk2 para impulsar el ciclo de las células, la inhibición parcial de Cdk2 en estas líneas [13,86-88] debería sensibilizar a las células a la inhibición de Cdk4. Un desafío con este enfoque es el riesgo asociado de que una fuerte inhibición de Cdk2 afecte no solo a la replicación del ADN en el ciclo anterior, sino también a la regulación del compromiso mitótico porque Cdk2-Ciclina A se ha vinculado directamente a la regulación de Wee1 y G2 / M transición [13,89–91].

Dada la variedad de medios por los que surge la resistencia a los inhibidores de Cdk4 / 6 [48], quizás sea más fácil probar empíricamente si una línea será susceptible de sincronía de inducción de Cdk4 / 6i. Una de dos evaluaciones simples identificará una línea como compatible con la sincronía de inducción Cdk4 / 6i. La detención / liberación en nocodazol que mostramos en las figuras 1 y 4-6 indicará la competencia de la mayoría de las líneas para sincronizar mediante la sincronía de inducción de Cdk4 / 6i: una línea se sincronizará si una población acumula 2 N de contenido de ADN una vez que se duplica después de la adición del inhibidor, antes de cambiar a contenido de ADN 4 N, un tiempo de duplicación adicional después de la liberación en nocodazol. Sin embargo, este ensayo se basa en la fuerza del SAC [71] que puede ser tan débil en algunas líneas que no logra imponer una detención del ciclo celular largo con un contenido de ADN de 4 N [92]. El segundo enfoque es independiente de la integridad de SAC. Las células se liberan de palbociclib en 1 µM de EdU antes de que se bloquee la entrada en el siguiente ciclo mediante la re-adición de palbociclib 12 h después de la liberación. Si EdU se incorpora a la mayoría de los genomas en una población que ha detenido la progresión del ciclo celular con un contenido de ADN de 2 N en respuesta a la segunda dosis de palbociclib, entonces la línea será competente para la sincronización.

Nuestras manipulaciones de la densidad celular y el historial de cultivo resaltan la importancia del estado de crecimiento y el historial de cultivo al personalizar el protocolo de sincronización para obtener la máxima sincronía en la línea elegida. La plasticidad del control G1 de compromiso con el ciclo está bien documentada. Distintos cambios transcripcionales y proteómicos acompañan a la salida del ciclo celular cuando un cambio del ciclo se desencadena por inhibición por contacto, inanición de suero o inhibición de la replicación del ADN, de manera que la historia de una célula altera la configuración de la señalización en células que ciclan activamente y aquellas que regresan de la inactividad [19 –22,59,72,80]. Por lo tanto, una historia reciente de inhibición por contacto reduce la eficiencia de la sincronización tras la liberación de palbociclib (compare el perfil en la figura 2B de células que se han mantenido en cultivo subconfluente antes de la manipulación, con eso si figura 2D que muestra la misma población inicial de células que habían experimentado un breve período de inhibición por contacto). Es probable que tal memoria de inhibición por contacto tenga impactos de amplio alcance, como lo ilustra la forma en que cambia la carga de factores de replicación en los orígenes en las células hTERT-RPE1 [93]. En consecuencia, se debe tener cuidado para garantizar que el camino de una población hacia la sincronización se haya dividido libremente y sea lo más "saludable" posible.

Si bien describimos la utilidad de la sincronía de inducción de palbociclib en el estudio del control y la ejecución del ciclo celular, la pausa del ciclo en el punto de restricción podría tener un beneficio considerable en otros campos, como la sincronización de la formación del cilio primario por agotamiento del suero de Cdk4 / 6i detención, o en el estudio de la diferenciación en sistemas, como la hematopoyesis, donde una pausa en G1 puede ser crucial para la diferenciación.

En conclusión, la búsqueda exitosa de generar fármacos para controlar la proliferación en la clínica [65] ha generado herramientas que serán de gran utilidad en los estudios de los cambios funcionales y bioquímicos que acompañan e impulsan la progresión del ciclo celular.

5. Conclusión

La sincronía de inducción de Cdk4 / 6 es un enfoque simple y reproducible que apoyará el interrogatorio bioquímico, la inducción, el agotamiento y el reemplazo de moléculas en cualquier escala de cultivo de líneas celulares. Los ensayos simples pueden determinar la competencia de este enfoque para sincronizar la progresión del ciclo celular en una nueva línea. Anticipamos que una serie de enfoques pueden convertir una línea recalcitrante en una línea compatible con sincronización Cdk4 / 6i.


Hanaoka, F. y Yamada, M., Biochem. Biophys. Res. Comun., 42, 647 (1971).

Tremblay, G. Y., Daniels, M. J. y Schaechter, M., J. Mol. Biol., 40, 65 (1969).

Ben-Porat, T., Stere, A. y Kaplan, A. S., Biochim. Biophys. Acta, 61, 150 (1962).

Levis, A. G., Krsmanovic, V., Miller-Faures, A. y Errera, M., Europ. J. Biochem., 3, 57 (1967).

Friedman, D. L. y Mueller, G. C., Biochim. Biophys. Acta, 174, 253 (1969).

Mizuno, N. S., Stoops, C. E. y Sinha, A. A., Naturaleza Nueva Biología, 229, 22 (1971).

Mizuno, N. S., Stoops, C. E. y Peiffer, junio, R. L., J. Mol. Biol., 59, 517 (1971).

Pearson, G. D. y Hanawalt, P. C., J. Mol. Biol., 62, 65 (1971).

Probst, H., Ulrich, A. y Krauss, G., Biochim. Biophys. Acta, 254, 15 (1971).

Hatfield, J. M. R., Exp. Cell Res., 72, 591 (1972).

O'Brien, R. L., Sanyal, A. B. y Stanton, R. H., Exp. Cell Res., 70, 106 (1972).

Comings, D. E. y Kakefuda, T., J. Mol. Biol., 33, 225 (1968).

Huberman, J. A. y Riggs, A. D., J. Mol. Biol., 32, 327 (1968).

Fujiwara, Y., Kondo, T., Kawamoto, Y. y Uchiyama, C., Gann, 63, 291 (1972).

Erlandson, R. A. y de Harven, E., J. Cell Sci., 8, 353 (1971).

Williams, C. A. y Ockey, C. K., Exp. Cell Res., 63, 365 (1970).

Fakan, S., Turner, G. N., Pagano, J. S. y Hancock, R., Proc. US Nat. Acad. Sci., 69, 2300 (1972).

Comings, D. E. y Okada, T. A., Exp. Cell Res., 62, 293 (1970).

Taylor, J. H., J. Biophys. Biochem. Cytol., 7, 455 (1960).

Kikuchi, T. y Sandberg, A. A., J. Nat. Cancer Inst., 32, 1109 (1964).

Mueller, G. C. y Kajiwara, K., Biochim. Biophys. Acta, 114, 108 (1966).

Terasima, T. y Yasukawa, M., Exp. Cell Res., 44, 669 (1966).

Lark, K. G., Bacteriol. Rvdo., 30, 3 (1966).

Huberman, J. A., Tsai, A. y Deich, R. A., Naturaleza, 241, 32 (1973).


Hanaoka, F. y Yamada, M., Biochem. Biophys. Res. Comun., 42, 647 (1971).

Tremblay, G. Y., Daniels, M. J. y Schaechter, M., J. Mol. Biol., 40, 65 (1969).

Ben-Porat, T., Stere, A. y Kaplan, A. S., Biochim. Biophys. Acta, 61, 150 (1962).

Levis, A. G., Krsmanovic, V., Miller-Faures, A. y Errera, M., Europ. J. Biochem., 3, 57 (1967).

Friedman, D. L. y Mueller, G. C., Biochim. Biophys. Acta, 174, 253 (1969).

Mizuno, N. S., Stoops, C. E. y Sinha, A. A., Naturaleza Nueva Biología, 229, 22 (1971).

Mizuno, N. S., Stoops, C. E. y Peiffer, junio, R. L., J. Mol. Biol., 59, 517 (1971).

Pearson, G. D. y Hanawalt, P. C., J. Mol. Biol., 62, 65 (1971).

Probst, H., Ulrich, A. y Krauss, G., Biochim. Biophys. Acta, 254, 15 (1971).

Hatfield, J. M. R., Exp. Cell Res., 72, 591 (1972).

O'Brien, R. L., Sanyal, A. B. y Stanton, R. H., Exp. Cell Res., 70, 106 (1972).

Comings, D. E. y Kakefuda, T., J. Mol. Biol., 33, 225 (1968).

Huberman, J. A. y Riggs, A. D., J. Mol. Biol., 32, 327 (1968).

Fujiwara, Y., Kondo, T., Kawamoto, Y. y Uchiyama, C., Gann, 63, 291 (1972).

Erlandson, R. A. y de Harven, E., J. Cell Sci., 8, 353 (1971).

Williams, C. A. y Ockey, C. K., Exp. Cell Res., 63, 365 (1970).

Fakan, S., Turner, G. N., Pagano, J. S. y Hancock, R., Proc. US Nat. Acad. Sci., 69, 2300 (1972).

Comings, D. E. y Okada, T. A., Exp. Cell Res., 62, 293 (1970).

Taylor, J. H., J. Biophys. Biochem. Cytol., 7, 455 (1960).

Kikuchi, T. y Sandberg, A. A., J. Nat. Cancer Inst., 32, 1109 (1964).

Mueller, G. C. y Kajiwara, K., Biochim. Biophys. Acta, 114, 108 (1966).

Terasima, T. y Yasukawa, M., Exp. Cell Res., 44, 669 (1966).

Lark, K. G., Bacteriol. Rvdo., 30, 3 (1966).

Huberman, J. A., Tsai, A. y Deich, R. A., Naturaleza, 241, 32 (1973).


El modelo representa el cambio en el contenido de ADN de una célula durante el ciclo celular.

El ciclo de vida de las células eucariotas generalmente se puede dividir en cuatro etapas y en la Figura 2.13 se muestra un ciclo celular típico. Cuando una célula se produce mediante fertilización o división celular, suele haber un retraso antes de que se someta a la síntesis de ADN (replicación). Este período de retraso se denomina Gap 1 (G1) y finaliza con el inicio de la fase de síntesis de ADN (S), durante la cual se replica cada cromosoma. Después de la replicación, puede haber otro retraso, llamado Gap 2 (G2), antes de la mitosis (M). Las células que experimentan meiosis no suelen tener una fase G2. Interfase es un término utilizado para incluir aquellas fases del ciclo celular que excluyen la mitosis y la meiosis. También existen muchas variantes de este ciclo celular generalizado. Algunas células nunca abandonan la fase G1 y se dice que entran en una etapa permanente que no se divide, llamada G0. Por otro lado, algunas células se someten a muchas rondas de síntesis de ADN (S) sin mitosis o división celular, lo que conduce a la endorreduplicación. Comprender el control del ciclo celular es un área activa de investigación, particularmente debido a la relación entre la división celular y el cáncer.

La cantidad de ADN dentro de una célula cambia después de cada uno de los siguientes eventos: fertilización, síntesis de ADN, mitosis y meiosis (Fig. 2.14). Usamos "c" para representar el contenido de ADN en una célula y "n" para representar el número de juegos completos de cromosomas. En un gameto (es decir, esperma u óvulo), la cantidad de ADN es 1c y el número de cromosomas es 1n. Tras la fertilización, tanto el contenido de ADN como el número de cromosomas se duplica a 2c y 2n, respectivamente. Después de la replicación del ADN, el contenido de ADN se duplica nuevamente a 4c, pero cada par de cromátidas hermanas aún se cuenta como un solo cromosoma (un cromosoma replicado), por lo que el número de cromosomas permanece sin cambios en 2n. Si la célula sufre mitosis, cada célula hija volverá a 2c y 2n, porque recibirá la mitad del ADN y una de cada par de cromátidas hermanas. En contraste, las 4 células que provienen de la meiosis de una célula 2n, 4c son cada una 1c y 1n, ya que cada par de cromátidas hermanas y cada par de cromosomas homólogos se divide durante la meiosis.

el agua es una molecula polar. un enlace químico es una fuerza de atracción entre átomos o iones. los enlaces se forman cuando los átomos comparten o transfieren electrones de valencia. los átomos forman enlaces químicos para alcanzar un nivel de energía exterior completo, que es la disposición más estable de electrones. entonces, falso

en la molécula de agua, dos moléculas de agua están unidas por un enlace de hidrógeno, pero el enlace entre dos enlaces h - o dentro de una molécula de agua es covalente. cuanto mayor es la diferencia de electronegatividad, más iónico es el enlace. Los enlaces que son parcialmente iónicos se denominan enlaces covalentes polares. Los enlaces covalentes no polares, con partes iguales de los electrones del enlace, surgen cuando las electronegatividades de los dos átomos son iguales.

las células usan algunos de los átomos de las moléculas de glucosa para atp moléculas. los átomos de las moléculas de glucosa se convertirán en energía que finalmente se almacenará en atp. la energía producida que se almacena en atp proviene de los enlaces químicos de la glucosa.


Opciones de acceso

Obtenga acceso completo a la revista durante 1 año

Todos los precios son precios NETOS.
El IVA se agregará más adelante en el proceso de pago.
El cálculo de impuestos se finalizará durante el pago.

Obtenga acceso completo o por tiempo limitado al artículo en ReadCube.

Todos los precios son precios NETOS.


MATERIALES Y MÉTODOS

Cepas de levadura y plásmidos

El tipo salvaje (PSY580) y NTF2 Se han descrito cepas de deleción (ACY114, ACY115) utilizadas en este estudio (Corbett y Silver, 1996). los MAD2 cepa de deleción, KH141, (ESTERAa, MAD2::URA3,leu2,3–112, trp1–63, ade2,su3-11,15) fue el generoso regalo de Andrew Murray. Los plásmidos de levadura, pPS882 (CEN, LEU2, NTF2), pPS883 (CEN, URA3, NTF2), pPS919 (CEN, LEU2, ntf2–1) y pPS920 (CEN, LEU2, ntf2–2) utilizados en este estudio (Corbett y Silver, 1996). Se ha descrito el plásmido de expresión bacteriana para Ntf2p (pPS982) (Wong et al., 1997). Se ha descrito el plásmido de proteína fluorescente verde NLS (GFP) (pGADGFP) utilizado para el ensayo de importación NLS-GFP (Shulga et al., 1996). Se ha descrito el plásmido para la expresión de la fusión C-terminal a la GFP (Kahana et al., 1995). Las construcciones de fusión a scRan (Gsp1p) se construyeron mediante la ingeniería de un marcoXhoSitio en el sitio de terminación del GSP1región de codificación y una PstI 710 pb aguas arriba del sitio de inicio 5 ′ del GSP1 región codificante (pAC410). Los plásmidos de expresión bacteriana para Ntf2–1p (pAC41) y Ntf2–2p (pAC43) se generaron mediante la clonación de un fragmento de PCR de ∼480-bp que contiene un 5′-BamSitio de la enzima de restricción HI y un 3′-Hinsitio de la enzima de restricción dIII introducido por amplificación por PCR de pPS991 (ntf2–1ts) o pPS920 (ntf2–2ts) con los cebadores AC21 (5′CGGGATCCATGTCTCTCG ACTTTAACAC3 ′) y AC88 (5′CCCGAAGCTTCGCTATCGCCTTATACATCG3 ′). El producto de PCR se clonó en el vector de expresión pMW172 basado en T7 (Way et al., 1990). Todos los procedimientos, incluidas las transformaciones de levadura, las manipulaciones de cultivos y las preparaciones de extractos, se realizaron mediante métodos estándar (Adamset al., 1997).

Purificación e inmovilización de Ntf2p

La levadura Ntf2p se purificó a partir de Escherichia coli como se describió anteriormente para Ntf2p de rata (Clarkson et al., 1996). Los plásmidos de expresión para Ntf2p (pPS982), Ntf2–1p (pAC41) o Ntf2–2p (pAC43) se transformaron en E. coli BL21 (DE3). Los transformantes se inocularon en medio de extracto de levadura-triptona 2X que contenía 100 µg de ampicilina / ml y se cultivaron durante la noche a 30ºC. No fue necesario inducir la expresión ya que el nivel basal de expresión de la polimerasa T7 produjo una gran cantidad de Ntf2p. Las bacterias se recolectaron por centrifugación y se almacenaron a -80 ° C hasta que se requirieron.

Se aisló Ntf2p descongelando el sedimento celular y resuspendiéndolo en sacarosa al 25%, Tris-HCl 50 mM (pH 8,0), MgCl 5 mM2, EDTA 1 mM, fluoruro de fenilmetilsulfonilo (PMSF) 0,1 mM. Las células se lisaron mediante prensa francesa y se trataron con ADNasa a 25ºC durante 30 min. La fracción soluble se aisló por centrifugación a 40.000 × gramo durante 20 min y se dializó durante la noche frente a Tris-HCl 20 mM (pH 8,0), MgCl 2 mM2, Ditiotreitol (DTT) 1 mM, PMSF 0,1 mM (tampón A de NTF2). El lisado se aclaró a 40.000 ×gramo durante 30 min a 4ºC, se aplicó a una columna de intercambio iónico DE52 (10 x 3 cm) y se lavó con tampón NTF2 A. Se eluyó Ntf2p de la columna con un gradiente de NaCl de 0 a 400 mM. Las fracciones que contenían Ntf2p se combinaron, se concentraron usando un concentrador Centriprep-10 (Amicon, Charlotte, NC) y se aplicaron a una columna de Sephacryl SR100 preequilibrada en Tris-HCl 20 mM (pH 7,4), NaCl 50 mM, MgCl 2 mM2, DTT 1 mM, PMSF 0,1 mM (tampón B de NTF2). Se recogieron y combinaron las fracciones que contenían Ntf2p.

El Ntf2p purificado se reticuló con perlas de bromuro de cianógeno (CNBr) -sepharose como se describió anteriormente (Clarkson et al., 1996). Brevemente, se hincharon perlas de CNBr-sefarosa (Pharmacia, Uppsala, Suecia) y se lavaron en HCl 1 mM. Las perlas se transfirieron a tampón de acoplamiento (NaHCO 100 mM3 (pH 8,3), NaCl 500 mM) y se añadieron a 2-5 mg de Ntf2p en tampón de acoplamiento. El acoplamiento se llevó a cabo a 4 ° C durante la noche. Los grupos activos residuales se bloquearon con Tris-HCl 1 M (pH 8,0) durante 2 horas a temperatura ambiente. A continuación, las perlas se lavaron sucesiva y extensamente cuatro veces en tampón de acoplamiento y tampón de lavado ácido (acetato de sodio 0,1 M (pH 4,0), NaCl 500 mM).

Ensayos de unión

Se prepararon extractos de células de levadura a partir de cultivos desarrollados durante la noche a 30ºC o a temperatura ambiente para las cepas ts en medio de extracto de levadura-peptona-dextrosa (YEPD) hasta la confluencia. Las células se recolectaron por centrifugación y se lavaron una vez con agua. A continuación, las células se resuspendieron en un volumen de PBSMT (1 x PBS, 2,5 mM de MgCl2, 0,5% Triton X-100) suplementado con inhibidores de proteasa (PMSF 0,5 mM y 3 μg de cada uno de aprotinina, leupeptina, quimostatina y pepstatina por mililitro). Se añadió un volumen de perlas de vidrio y las células se lisaron con 10-15 pulsos de 60 s en un batidor de perlas (la lisis se controló mediante microscopía óptica hasta & gt70% de lisis). El lisado resultante se aclaró por centrifugación y se ensayó para determinar la concentración de proteínas utilizando el kit de ensayo de proteínas Bio-Rad (Cambridge, MA).

Se incubaron dos miligramos de lisado de levadura con 50 µl de perlas de Ntf2p-sefarosa. La unión se llevó a cabo en PBSM (volumen total, 500 μl) a 4 ° C durante 1 h. A continuación, las perlas se lavaron dos veces durante 10 min en PBSM y una vez durante 10 min en PBSMT. Las proteínas unidas se eluyeron con 100 µl de tampón de muestra y se resolvieron mediante electroforesis en gel de poliacrilamida-SDS y se transfirieron a nitrocelulosa para inmunotransferencia.

Análisis de inmunotransferencia

El análisis de inmunotransferencia se realizó esencialmente como se describe (Towbin et al., 1979) con las siguientes modificaciones: después de la transferencia, el filtro de nitrocelulosa se bloqueó en tampón TBST (Tris 10 mM, NaCl 140 mM, Tween-20 al 0,05%) más leche al 5% durante 15 min. Los filtros que se utilizarían para la detección de scRan se bloquearon con TBS1 / 2T (tampón TBS que contenía Tween-20 al 0,025%) durante 15 min. scRan-GFP se detectó mediante incubación con una dilución 1: 5000 (en TBST más leche al 5%) de un anticuerpo policlonal de conejo anti-GFP (el generoso obsequio de P. Silver y J. Kahana, Harvard Medical School, Boston, MA) . scRan se detectó mediante incubación con una dilución 1: 1000 (en TBS1 / 2T más leche al 5%) de un anticuerpo policlonal de conejo antiscRan (el generoso obsequio de D. H. Wong y P. Silver, Harvard Medical School). Después de varios lavados con TBST (o TBS1 / 2T para scRan), el filtro a continuación se incubó en una dilución 1: 5000 de antisuero policlonal de cabra anti-conejo unido a peroxidasa de rábano picante (Promega, Madison, WI) durante 1 ha temperatura ambiente. El filtro se lavó de nuevo en TBST (o TBS1 / 2T para scRan) y la detección se llevó a cabo con una mezcla 1: 1 de reactivos ECL (quimioluminiscentes) (Amersham, Little Chalfont, Reino Unido) según lo recomendado por el fabricante.

Localización de scRan-GFP y Nuf2-GFP

El scRan-GFP y Nuf2-GFP (Kahana et al., 1995) se localizaron proteínas de fusión observando directamente la señal de GFP en células vivas a través de un filtro optimizado para GFP (Chroma Technology, Brattleboro, VT) utilizando un microscopio de epifluorescencia Olympus (Tokio, Japón) BX60 equipado con un sistema fotométrico (Tucson, AZ) Cámara digital Quantix.

Microscopía de inmunofluorescencia indirecta

Se cultivaron cultivos de diez mililitros hasta la fase logarítmica en YEPD durante la noche, luego se dividieron los cultivos y se mantuvo la mitad durante 3 ha 25 ° C y la mitad se cambió a 37 ° C durante 3 h. A continuación, los cultivos se fijaron con 600 µl de formaldehído al 37% durante 30 min. Después de la fijación, las células se recolectaron por centrifugación y se lavaron una vez con tampón de fosfato de potasio 0,1 M (pH 6,5), una vez con solución de P (sorbitol 1,2 M, tampón de fosfato de potasio 0,1 M, pH 6,5) y se resuspendieron en 1 ml de P solución. Se añadió DTT a 25 mM y las células se incubaron a 30ºC durante 10 min con agitación suave seguida de la adición de 300 µg de zimoliasa (United States Biological, Swampscott, MA). La digestión de la pared celular se controló mediante microscopía. Las células digeridas se recogieron por centrifugación, se lavaron una vez con solución P y se resuspendieron en 1 ml de solución P. A continuación, las células se aplicaron a portaobjetos de microscopio con caras de teflón recubiertos previamente con polilisina al 0,3%. Después de que las células se adhirieron a los portaobjetos, se fijaron con metanol a -20 ° C durante 6 min y se secaron en acetona fría durante 30 s. Las células se bloquearon incubando durante 15 min con PBS más albúmina de suero bovino (BSA) al 0,5%. La antitubulina se diluyó 1: 100 y el anti-Npl3p se diluyó 1: 1000 en PBS más BSA al 0,5% y se incubó con las células durante la noche a temperatura ambiente. Las células se lavaron varias veces con PBS más BSA al 0,5% y se incubaron durante 2 h con una dilución 1: 1000 de anticuerpos anti-ratón marcados con isotiocianato de fluorosceína (FITC) o anticuerpos anti-ratón marcados con Texas Red (Jackson ImmunoResearch, West Grove, PA) para antitubulina o con antirabbit marcado con FITC para Npl3p como se indica y con 4 ′, 6-diamido-2-fenilindol (anticuerpos DAPI) (1 μg / ml).

Crecimiento y viabilidad

NTF2, ntf2–1, y ntf2–2 las células se cultivaron en YEPD durante la noche a 25ºC, se diluyeron a 2 x 106 células / ml y se cambiaron a 37ºC. El crecimiento se controló contando las células cada 2 h usando un hemacitómetro. La viabilidad se controló cada 2 h colocando 200 células / placa en placas YEPD. Las placas se incubaron a 25 ° C durante 4 días y se contaron las colonias.

Determinación del contenido de ADN de células de levadura

Las células se prepararon para FACS mediante tinción con yoduro de propidio (Epstein y Cross, 1992). Brevemente, las células se fijaron con etanol durante la noche a 4ºC, se lavaron y se resuspendieron en 1 ml de citrato de sodio 50 mM, pH 7,0. A continuación, las células se trataron con 0,08 mg / ml de Rnasa A durante 1 ha 50ºC seguido de 0,25 mg / ml de proteinasa K antes de la incubación en 8 µg / ml de yoduro de propidio. Cada muestra se analizó con un citómetro FACS Calibre de Becton Dickinson (Franklin Lakes, Nueva Jersey).

Construcción y análisis de cepas MAD2Δ

Para construir el ntf2ts MAD2Δ, mutantes dobles, KH141 (MAD2Δ) se apareó con ACY115 (NTF2Δ) que contiene pPS919 (ntf2–1ts) o pPS920 (ntf2–2ts). Los diploides resultantes se esporularon y se disecaron tétradas para aislar las cepas de doble mutante. Se cultivaron mutantes simples y dobles así como controles de tipo salvaje durante la noche en YEPD a 25ºC. Las células se diluyeron a 0,2 x 106 células / ml en 50 ml de YEPD, se cultivaron la mitad a 25ºC y la mitad se desplazaron a 37ºC. El crecimiento se controló midiendo la DO600. Para probar la sensibilidad al benomilo de las cepas de levadura indicadas, las células se cultivaron durante la noche a 25 ° C y se colocaron 100.000, 10.000, 1.000, 100 y 10 células en placas de benomilo de 10 μg / ml y se incubaron a 25 ° C. Para probar la sensibilidad al nocodazol de las cepas de levadura indicadas, las células se cultivaron durante la noche a 25 ° C y se diluyeron a 0,2 x 106 células / ml en YEPD que contenía 15 μg / ml de nocodazol, y el crecimiento se controló mediante DO.600.

Ensayo de importación NLS-GFP

El ensayo de importación NLS-GFP se realizó como se describió anteriormente (Shulga et al., 1996). Brevemente, las células se cultivaron hasta la fase temprana-midlog en medio sintético que contenía glucosa al 2% a 25 ° C, se sedimentaron y se resuspendieron en 1 ml de azida sódica 10 mM y 2-desoxi-d -glucosa 10 mM en sintético sin glucosa. medio, y se incubaron a 25 ° C durante 45 min. Las células luego se sedimentaron, se lavaron con 1 ml de ddH enfriado con hielo.20, se repitieron, se resuspendieron en 100 μl de medio sintético que contiene glucosa precalentado a 37 ° C y se incubaron a 37 ° C.Para la puntuación, se extrajeron muestras de 2 μl cada 2,5 min, y las células se observaron y contaron a través de un filtro optimizado de GFP (Chroma Technology) utilizando un microscopio de epifluorescencia Olympus BX60. Las células se puntuaron como "nucleares" si el núcleo era más brillante que el citoplasma circundante y era visible un límite nuclear-citoplasmático. Se contaron al menos 50 células en cada momento.


Control del ciclo celular

los "Ciclo de vida" de una célula eucariota no embrionaria en división comienza con la célula activada para entrar en el ciclo celular y termina con la partición equitativa del material genético y la división de la célula durante la citocinesis. Todo el proceso se llama ciclo celular y consta de cuatro fases principales.

La entrada al ciclo se realiza en la fase Gap 1 (G1) y esta es seguida en secuencia por una fase de síntesis de ADN (S), una fase Gap 2 (G2) y Mitosis (M). Después de la mitosis (M), algunas células entran en la fase G1 de un nuevo ciclo celular, mientras que otras pueden divergir al comienzo de G1 en una fase llamada Gap O (cero). Las fases G1, S y G2 a menudo se agrupan y se denominan "interfase".

Las celdas en G-0 (cero) están inactivas y no se dividen (por lo tanto, cero), esto puede ser permanente o temporal.
La mitosis (fase M) se había observado y descrito con cierto detalle a principios del siglo XX, pero no fue hasta unos 50 años después que se descubrió que la síntesis de ADN tenía lugar como un proceso separado antes de la mitosis. Entre la mitosis (M) en un ciclo celular anterior y la síntesis de ADN (S) hubo un intervalo de tiempo. Este fue designado Gap 1 (G1). El intervalo de tiempo entre la síntesis de ADN (S) y la mitosis (M) se denominó Gap 2 (G2).

Después de la división celular, las células hijas siguen UNA de varias vías:

  • las células que pueden volver a dividirse entran inmediatamente en la fase G1 de un nuevo ciclo celular.
  • otras células entran en la fase G-0. Algunos de ellos permanecen inactivos durante un tiempo, pero luego vuelven a entrar en la fase G1.
  • algunas células especializadas, por ejemplo, las células nerviosas, no se vuelven a dividir.
  • otras células pueden activarse mediante actividades como la reparación de heridas para que entren en la fase G1 del ciclo celular y se dividan según sea necesario.

La mitosis es visualmente muy dramática, pero solo ocupa alrededor del 5% del tiempo total del ciclo celular. Dentro del "panorama general" del ciclo de vida de una célula en división, la interfase (fases G1, S y G2) representa el otro 95% del tiempo del ciclo celular. La evidencia de la investigación muestra que la interfase (¡una vez llamada fase de reposo!) Opera de una manera sistemática hermosamente ordenada. También se ha demostrado que es más complicado de lo que se pensaba.

El tiempo que tarda una célula eucariota en dividirse varía mucho según el tipo de célula y el entorno. Las células de levadura tardan entre 1,5 y 3 horas, las células epiteliales intestinales alrededor de 12 horas y las células en cultivo alrededor de 22 horas. En diferentes organismos y en diferentes momentos de desarrollo, los detalles del ciclo celular varían. Las células embrionarias de muchos organismos tienen un ciclo más corto que el de células similares en el adulto. Las células de levadura y de mamífero muestran diferencias en los detalles del ciclo, pero el mecanismo general del ciclo celular se ha conservado en gran medida a lo largo de los años.

Durante el ciclo celular, la química citoplasmática influye en gran medida en las actividades de toda la célula. En todos los demás momentos pensamos en términos de que el núcleo celular determina la actividad citoplasmática.
CONCEPTOS CLAVE:

  • El ciclo celular es una instalación de producción de células de alta calidad.
  • Una instalación de producción eficiente debe tener un sistema controlado, coordinado y secuencial para producir productos. También se necesita un sistema para monitorear las materias primas entrantes, el procesamiento del producto, el entorno de procesamiento y la instalación para anticipar y tratar los problemas de producción.
  • La célula eucariota es un "buen fabricante", ¡la mayor parte del tiempo! Durante el ciclo de división celular, cuenta con el equivalente biológico de los siguientes sistemas: Garantía de calidad (QA), Control de calidad (QC) y, como parte de QC, Seguridad interna (SI).
  • En ciertos puntos del ciclo, QA y QC toman "revisiones y decisiones" críticas. Estos eventos se denominan "puntos de control".

El sistema del ciclo celular de un organismo eucariota incluye:

  1. una capacidad de vigilancia biomolecular que integra señales extracelulares e intracelulares e informa al QA y QC de la célula sobre: ​​la necesidad de una nueva célula la disponibilidad de materias primas incluyendo una cantidad considerable de energía química si el microambiente es adecuado para la división celular y, la integridad de el genoma y la fidelidad de su replicación (principalmente QA).
  2. un sistema que controla el ciclo del ciclo y asegura que la celda solo ingresa a la siguiente fase cuando el paso por la anterior es completo y que las fases del ciclo celular se ingresan en el orden correcto. El paso satisfactorio a través de las cuatro fases y, por lo general, los diversos puntos de control del ciclo celular son fundamentales para la división celular (CC).
  3. un sistema de control que inicia y termina las reacciones químicas en el ciclo celular y, con el uso de una forma de "autorización", asegura que el ADN se replica una vez y solo una vez durante la fase S (QC e IS).
  4. funciones de detención y retardo del ciclo celular (CC).
  5. Instalaciones de detección y reparación de daños en el ADN y un sistema que detecta ADN no replicado y, en la mitosis, un sistema para garantizar el ensamblaje del huso y la unión cromosómica (QA / QC) adecuados, & # 8211 también conocidos como "puntos de control", y
  6. la capacidad y la facilidad para desencadenar la muerte celular programada (apoptosis) (QC).

Una célula se "cicla" a través de cada fase y de una fase a otra por la acción de proteínas, incluidas ciclinas específicas y quinasas dependientes de ciclina (cdks). Diferentes ciclinas y cdk aumentan y disminuyen su actividad durante el ciclo celular.

A veces, las fallas pasan desapercibidas (como en la industria). Los sistemas de garantía y control de calidad también pueden fallar. La falla del sistema de control de calidad está asociada con enfermedades de células y órganos y probablemente hasta el 50% de los cánceres (pero esto no significa que una sola falla del sistema por sí sola causará cáncer).
CONCEPTOS CLAVE: INFORMACIÓN DE APOYO A NIVEL DE ENTRADALas células de eucariotas normalmente solo se dividen cuando se les indica que lo hagan. Las sustancias químicas llamadas mitógenos indican a las células que comiencen a dividirse. Las células competentes para dividirse se unen al ciclo celular en la fase G1 y permanecen en esta fase durante un poco menos de la mitad del tiempo total del ciclo celular. Esta es la fase más larga y las condiciones microambientales y las señales recibidas de otras células pueden acortar o alargar G1.Fase G1 temprana
Un trabajo reciente sugiere que un sistema de licencias para "una sola copia de ADN" se establece al principio de la fase G1 y expira solo después de que la replicación del ADN haya comenzado en la fase S. Durante la fase G1, solo está presente un conjunto del genoma.

Fase G1 tardía
Los principales impulsores de la progresión a través del ciclo celular se denominan proteína quinasas. Hay varios de estos y cada uno es una combinación de una ciclina y una enzima catalítica llamada quinasa dependiente de ciclina (cdk).
Las diferentes combinaciones operan en partes específicas del ciclo celular y aumentan y disminuyen en actividad durante el ciclo. Al hacerlo, contribuyen al mecanismo de entrada y salida de fase. El nivel elevado de actividad de las diversas combinaciones de ciclina y cdk se termina mediante la proteólisis de ciclinas después de la poliubiquitinación. (Las ubiquitinas son un grupo de proteínas que están unidas covalentemente a proteínas destinadas a la degradación. Después de la unión molecular, las proteínas diana, en este caso las ciclinas, se degradan por proteólisis, es decir, desprendimiento de proteínas del griego lusis, "aflojamiento").

La primera combinación de ciclina (ciclina D y cdk 4 y 6) se dispara en aproximadamente tres cuartas partes del camino a través de la fase G1 para unirse más tarde con la combinación de ciclina E y cdk 2, ambas ciclinas conducen a la célula a la fase S

Aproximadamente en este momento, la célula pasa por el "Punto de restricción" (en las levaduras llamado START). Este es un punto de "no retorno", el ciclo celular equivalente a "César cruzando el Rubicón". Una vez que la celda pasa este punto, está restringida, no hay vuelta atrás, la celda se compromete a replicar en la fase "S".

Puntos de control

A medida que la célula avanza a través del ciclo, se encuentran puntos de control. Aunque no son absolutamente esenciales para la división celular, son características bien establecidas de la mayoría de las células.
Los puntos de control en el ciclo celular no son diferentes a los que se encuentran en algunos cruces fronterizos donde se controlan los pasaportes, papeles y mercancías. A nivel molecular, un punto de control del ciclo celular consta de (1) sensor / detector (2) un transmisor de señal y (3) un receptor / efector.

Puesto de control G1
El primero de los "puntos de control de vigilancia" se encuentra hacia el final de la fase Gap1 (G1) y es el punto de control de daños en el ADN G1. En este punto de control y justo delante de él, el ADN de la célula seleccionada para dividirse se somete a vigilancia biomolecular para verificar su integridad. En los seres humanos, el daño del ADN se 'autoseñaliza' principalmente por el propio ADN dañado que eleva el nivel y la actividad de los productos proteicos de ciertos genes, especialmente los del gen supresor de tumores p53 del cromosoma 17. El gen p53 se denomina el 'guardián de la genoma 'y es en gran parte responsable de determinar si la célula debe ser admitida en la siguiente fase de síntesis (S). Si el ADN no está demasiado dañado, puede ser posible una reparación y el ciclo celular se detiene y se ralentiza hasta que se efectúan las reparaciones. El "control de calidad" del ciclo celular puede determinar que el daño no se puede reparar. En este caso, "p53" activará la función de muerte celular programada (apoptosis).

El ciclo de división de una célula con ADN muy dañado puede terminar en este punto de control.

Desafortunadamente, el control de calidad en las células no es perfecto. Muy ocasionalmente, el control de calidad pasa por alto el daño del ADN y el ADN ligeramente modificado se desliza a través del sistema. A veces, esto se debe a que el ADN dañado no activa el sistema de puntos de control. El sistema de control de calidad también puede dañarse. El ADN del gen p53 puede resultar dañado por la luz solar (radiación ultravioleta) y sustancias químicas mutagénicas, incluidas las del humo del cigarrillo y las aflatoxinas de, por ejemplo, cacahuetes mohosos.

En el punto de control G1 en el ciclo celular de la levadura, se realiza una verificación para garantizar que el tamaño celular sea el correcto para la división, pero se ha descubierto que el tamaño celular no es un factor tan crítico en algunas células de eucariotas superiores.

Fase S (síntesis de ADN)

La fase S ocupa aproximadamente un tercio del tiempo total del ciclo celular. Es aquí donde, bajo el sistema de "licencias", solo se sintetiza una nueva copia del ADN de la célula. Esto incluye alteraciones aceptables pero también cuestionables no detectadas por QC debido a errores y averías del sistema. La falla del gen p53 "guardián del genoma" para operar debido al daño dentro de su propio ADN es un ejemplo de esto.

En la fase S, el ADN de doble hebra se desenrolla en dos hebras de componentes que sirven como plantillas para la síntesis de una nueva hebra en cada una. Las unidades recién formadas de las bases adenina (A), timina (T), guanina (G) y citosina (C) se unen para complementar las bases del ADN desenrollado. Ahora se produce un conjunto de ADN para cada una de las dos células hijas. El proceso de síntesis de ADN consume una cantidad considerable de energía. (Para obtener detalles de este proceso, consulte los libros de texto que figuran en nuestro sitio web, por ejemplo: Pollard, T. D. & amp Earnshaw, W. C., ‘Cell Biology’ 1st Edit. 2002. 2nd print, with added 2004. Publ: W. B. Saunders).

Puntos de control de la fase S
Parece haber tres tipos de puntos de control en la fase S. No es sorprendente que todos respondan de alguna manera a los problemas con la replicación del ADN. Estos problemas van desde la escasez de desoxirribonucleótidos para producir nuevo ADN hasta la presencia de sustancias químicas inhibidoras de enzimas y roturas en la molécula de ADN. El ciclo celular puede detenerse aquí si el ADN no se replica o de alguna manera está incompleto y no es competente para pasar a la fase G2.
Si todo va bien al final de la fase S, la célula contendrá dos conjuntos idénticos de su genoma.

El ciclo es impulsado a través de la fase S y en la fase G2 por la combinación de ciclina A y cdk 2.

Fase G2 (Gap 2)
La fase G2 es generalmente más corta que la de G1. Gran parte de este tiempo se dedica a desarrollar y preparar orgánulos para dividirse y compartir durante la citocinesis al final de la mitosis. Las ciclinas A y B acopladas a cdk 1 impulsan la celda a través del final de la fase S, a través de la fase G2 y la fase M Esta fase contiene el punto de control G2. Después de G2, la celda está comprometida con la división.

Punto de control G2
Este punto de control de la estructura del ADN se encuentra hacia el final de la fase G2. El punto de control G2 es muy crítico porque tiene la función "responsable" de proporcionar un control de garantía de calidad antes de que la célula entre en mitosis.

  1. se lleva a cabo un seguimiento para garantizar que no haya ADN no replicado y que DOS conjuntos idénticos del genoma estén presentes e intactos.
  2. ambos conjuntos del genoma están "revisados" con un alto nivel de vigilancia. Se realiza una verificación de daño molecular dentro del ADN y esta evidencia determinará si el genoma será retenido, reparado o rechazado.
  3. si es posible reparar el ADN dañado, el ciclo celular se detiene mientras dure la reparación. Los ciclos celulares operan en "tiempo real", por lo que el control de calidad puede acomodar la demora dentro del sistema retrasando eventos futuros.
  4. Se identificará el ADN muy dañado y los productos del gen p53 desencadenarán el programa de muerte programada (apoptosis).
  5. El "control de calidad" comprobará la competencia general de la célula para entrar en la mitosis. En la lista de competencias se incluirán elementos como "¿está en su lugar el mecanismo que conduce a la separación de las cromátidas hermanas?" & Lt

Fase M (mitosis)
La mitosis presenta el drama de la división. Una presentación impresionante y hermosa, ocupa solo el 5% del tiempo total del ciclo celular, o aproximadamente una hora en células cultivadas de eucariotas superiores. Es la fase más corta pero la producción final es la culminación del trabajo realizado durante el resto del ciclo celular.

La ciclina A y B acopladas a cdk 1 impulsa la célula a través de la mitosis (se remite al estudiante a un libro de texto en el nivel deseado para obtener información detallada sobre la mitosis). Al final de la mitosis, las cromátidas hermanas, unidas como pares por "pegamento" cohesivo desde que se replicaron en la fase S, se separan para formar dos nuevos conjuntos equivalentes de cromosomas. Este evento es la segregación cromosómica.

Algunos orgánulos del citoplasma se desmontan en unidades moleculares que se dividen durante la división del citoplasma (cinesis) y luego se construyen otros nuevos en las células hijas. Otras inclusiones citoplasmáticas se comparten (no siempre de manera uniforme) entre las células hijas.

Puntos de control de la fase M (mitosis)

El funcionamiento de un punto de control dentro de la mitosis, el punto de control de la metafase, está bien establecido. Puede haber más puntos de control, pero se necesita más trabajo para establecer su existencia.

Punto de control de metafase

También llamado "punto de control de unión de ensamblaje del huso o cinetocoro", opera durante la metafase y antes de que la célula entre en anafase. Comprueba si hay cromosomas desalineados y también si los microtúbulos están unidos a los cinetocoros, un mecanismo muy crítico. El inicio de la anafase se retrasa hasta que todos los cromosomas estén alineados y adheridos apropiadamente.

Cuando la telofase se completa, tiene lugar la citocinesis & # 8211 (la división del citoplasma). Después de esto, las dos células hijas se dirigirán a la fase G-0 (cero) o G1.

MENSAJES CONCEPTUALES:

  1. La evidencia de la investigación muestra muy claramente que la división celular en eucariotas ahora debe verse como un proceso multifase activo llamado CICLO CELULAR. El proceso está altamente conservado y cubre todas las fases de preparación así como la división celular propiamente dicha. El paso satisfactorio por las fases y los puntos de control del ciclo son fundamentales para que se produzca la división celular.
  2. La mitosis, aunque obviamente es muy importante y dramática, debe verse como parte del "panorama general" de la división celular. La mitosis ocupa solo el 5% del tiempo total del ciclo celular.
  3. Trabajando dentro del ciclo celular hay varias formas de aseguramiento y control de la calidad molecular. Estos controles funcionan para ayudar al programa de división celular y prevenir daños al genoma.

DESAFÍE SU PENSAMIENTO CRÍTICO:

  • El cáncer se trata de células que se dividen de manera no regulada. La naturaleza del sistema de control del ciclo celular se presta al diseño de medicamentos contra el cáncer que interrumpen el ciclo celular e inician la muerte celular programada.
    Considere el ciclo celular total. ¿Seleccionar dos o más sitios estratégicos como posibles objetivos para la acción de los medicamentos contra el cáncer? Piense en términos de biología celular y molecular qué le gustaría que hiciera el medicamento para interferir con el ciclo celular.
  • Si la replicación del ADN y la división celular fueran siempre perfectas en todos los casos, ¿cuáles serían las implicaciones para la evolución?

SITIOS WEB SELECCIONADOS:
http://nobelprize.org
Haga clic en el juego Cell Cycle en el panel de educación.

http://www.cancerresearchuk.org
Haga clic en "Ciencia e investigación" en el texto. (Luego, seleccione Informes anuales, especialmente LRI 2002 y amp Sc.Yearbook 02/03)

http://www.cellsalive.com
Haga clic en "ciclo celular" (seleccione "puntos de control para la animación").

Agradecemos profundamente a Margarete Heck por su valiosa contribución.


Ver el vídeo: Síntesis Conceptual 3 Regulación ciclo celular (Julio 2022).


Comentarios:

  1. Kilabar

    Lo siento, pero creo que estás equivocado. Puedo defender mi posición. Envíeme un correo electrónico a PM, hablaremos.

  2. Dular

    Confirmo. Y lo he enfrentado. Podemos comunicarnos sobre este tema.

  3. Dary

    En particular no hay ninguno

  4. Michele

    He eliminado esta idea :)



Escribe un mensaje