Información

¿Cómo puedo determinar la pureza de las células aisladas de cerebros de ratas si no puedo usar FACS, inmunohistoquímica o análisis SEM?

¿Cómo puedo determinar la pureza de las células aisladas de cerebros de ratas si no puedo usar FACS, inmunohistoquímica o análisis SEM?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Por favor ayuda.

Sé cómo aislar las diferentes células (astrocitos, otras células gliales, neuronas y sinaptosomas) del tejido cerebral mediante una separación basada en Ficoll, pero ¿cómo puedo determinar la pureza de las fracciones que he aislado si no puedo utilizar técnicas inmunológicas, FACS? o análisis SEM.


Puede hacer qPCR para ciertos marcadores del extracto. GFAP para astrocitos, Tuj1 para neuronas, mielina para oligodendrocitos, etc. y calcula sus porcentajes para tener una estimación de las poblaciones relativas. Si está bastante acostumbrado a la microscopía y al estudio de estas células, también puede identificar las diferentes poblaciones de células con microscopía de luz normal; esto no es cuantitativo y es susceptible de sesgo.


Una combinación de tres fármacos reutilizados administrados en la reperfusión como una terapia prometedora para la lesión cerebral posisquémica

La isquemia cerebral conduce a una lesión multifacética del cerebro. Un fármaco politerapéutico que se puede administrar inmediatamente después de la reperfusión puede aumentar la protección del cerebro al dirigirse simultáneamente a múltiples cascadas deletéreas. Este estudio evaluó la eficacia de la combinación de tres fármacos clínicamente aprobados: lamotrigina, minociclina y lovastatina, utilizando dos modelos de ratón: isquemia cerebral global y focal inducida por oclusión transitoria de las arterias carótidas comunes o la arteria cerebral media, respectivamente. In vitro, el fármaco combinado, pero no el fármaco individual, protegió a las neuronas contra la muerte celular inducida por la privación de oxígeno y glucosa (OGD). El fármaco combinado se dirigió simultáneamente a la apoptosis celular y al daño del ADN inducido por isquemia. Además de actuar sobre las neuronas, el fármaco combinado suprimió los procesos inflamatorios en la microglía y las células endoteliales cerebrales inducidos por isquemia. En un modelo de isquemia global transitoria, el fármaco combinado, pero no el fármaco único, suprimió la activación microglial y la producción de citocinas inflamatorias, y redujo el daño neuronal. En un modelo de isquemia focal transitoria, el fármaco combinado, pero no el fármaco único, atenuó el infarto cerebral, suprimió la infiltración de neutrófilos periféricos y redujo los déficits neurológicos después de un accidente cerebrovascular isquémico. En resumen, el fármaco combinado confiere una protección de amplio espectro contra la lesión por isquemia / reperfusión (I / R) y podría ser un enfoque prometedor para la neuroprotección temprana después de un paro cardíaco extrahospitalario o un accidente cerebrovascular isquémico.

Esta es una vista previa del contenido de la suscripción, acceda a través de su institución.


Introducción

El citomegalovirus humano (HCMV) es un herpesvirus de alta prevalencia que infecta a una gran proporción de personas en todo el mundo. La infección primaria de individuos sanos suele ser asintomática, seguida del establecimiento de latencia. Sin embargo, la infección o reactivación por HCMV en individuos inmunodeprimidos o inmunológicamente inmaduros puede conducir a una enfermedad grave o potencialmente mortal. La infección congénita por HCMV es una de las principales causas infecciosas de secuelas del neurodesarrollo a largo plazo, que incluyen retraso mental y pérdida auditiva neurosensorial 1. El HCMV es un virus estrictamente específico de la especie, por lo que los citomegalovirus animales se utilizan a menudo para investigar la inmunobiología y la patogenia de la infección. La infección de ratones con citomegalovirus de ratón (MCMV) es el modelo más común de infección por HCMV 2. Dado que MCMV no atraviesa la placenta, empleamos un modelo de infección congénita en el que los ratones recién nacidos se infectan con MCMV por vía intraperitoneal en el primer día postnatal (PND 1) 3. Vale la pena mencionar que el SNC en ratones recién nacidos tiene un desarrollo equivalente al del feto humano a las 15 semanas de gestación, un período de tiempo en el que la infección por HCMV en humanos se adquiere con mayor frecuencia durante el embarazo 4. Tras la infección por MCMV de ratones recién nacidos, el virus se disemina a varios tejidos, incluido el cerebro, donde la infección da como resultado una encefalitis no necrosante, focal y generalizada 3. La patología del SNC en ratones recién nacidos infectados recapitula de cerca la patología que ocurre durante la infección congénita por HCMV, más evidente en un cerebelo de menor tamaño y una capa granular externa más gruesa 3, 5. Además, la infección provoca una pérdida de audición asociada con la inflamación del oído interno y la pérdida de las neuronas de los ganglios espirales 6. Nosotros y otros hemos demostrado que la infección por MCMV en ratones recién nacidos induce una fuerte respuesta inflamatoria en el cerebro caracterizada por la activación de la microglía, el reclutamiento de células inmunes periféricas activadas y la expresión de citocinas proinflamatorias 3, 4, 7. De hecho, la inflamación inducida por virus, más que el efecto citopático del virus en las células infectadas, es responsable de las anomalías del neurodesarrollo 7. La población dominante de linfocitos que se infiltran en el cerebro tras la infección son las células T CD8 + 8. Hemos demostrado previamente que las células T CD8 + son esenciales para el control de la infección por MCMV en el cerebro y para la supervivencia de los ratones recién nacidos tras la infección 8. Las células T CD8 + específicas del virus permanecen en el cerebro incluso después de la resolución de la infección productiva 8-10. Sin embargo, la dinámica de estas células y su biología siguen estando poco caracterizadas.

Las células T CD8 + de memoria se dividen clásicamente en dos grupos: memoria central (TCM) y memoria efectora (TEM). TCM circulan entre los ganglios linfáticos y la sangre y dan lugar a las nuevas células efectoras al reencontrarse con el antígeno, mientras que TEM circulan entre los tejidos linfoides y no linfoides y pueden realizar funciones efectoras inmediatas tras el encuentro con el antígeno 11. Un nuevo grupo de células T CD8 + de memoria, células T de memoria residentes en tejidos (TRM células), se ha identificado que proporciona una protección superior contra las infecciones secundarias locales [12]. De hecho, la mayoría de las células T de memoria se encuentran en tejidos no linfoides 13. TRM las células se caracterizan por la expresión de marcadores de superficie CD69 y CD103, y características moleculares, funcionales y metabólicas distintas 12, 14-16. Aunque el SNC se considera un sitio inmunológico privilegiado, las infecciones del SNC con varios virus se han asociado con la infiltración de linfocitos y el desarrollo de TRM celdas 17. Esto es particularmente importante para las infecciones crónicas persistentes que proporcionan un suministro constante de antígeno que puede estimular las células T de memoria ya preparadas. En tales condiciones, es necesario establecer un delicado equilibrio entre el control del virus y la evitación de la patología cerebral.

Aquí, caracterizamos las células T CD8 + que persisten en el cerebro de ratones infectados perinatalmente con MCMV. Mostramos que tras la infección por MCMV de ratones recién nacidos, las células T CD8 + específicas del virus forman un grupo de TRM células que se retienen en el cerebro durante toda la vida. Las células T CD8 + específicas del virus transferidas de manera adoptiva brindan protección contra la infección primaria por MCMV, reducen la patología cerebral y permanecen en el cerebro como TRM células. Es importante destacar que CD8 + TRM las células responden al desafío y previenen la reactivación de virus latentes, así como la patología inducida por reactivación.


Resultados

La administración sistémica de ácido kínico induce neurodegeneración, inflamación e infiltración retardada de monocitos.

Para determinar si los monocitos circulantes que expresan CCR2 se infiltran en el cerebro después de SE, heterocigotos Ccr2 + / rfp A los ratones se les inyectó por vía intraperitoneal solución salina o una dosis única de ácido kaínico (KA 30 mg / kg). La gravedad de las convulsiones se registró cada 5 min durante 5 h según una escala de Racine modificada para KA (fig.1mi). El tejido cerebral se examinó histológicamente en busca de evidencia de degeneración neural del hipocampo, microgliosis e invasión de los monocitos circulantes 1, 3 y 14 días después de la administración de KA. En comparación con los animales tratados con solución salina, los ratones que entraron en SE mostraron un fuerte adelgazamiento y destrucción de la capa de células piramidales en el subcampo CA3 del hipocampo mediante tinción con violeta de cresilo, lo que indica degeneración neuronal en los puntos de tiempo examinados (Fig.1A). Estos datos confirman el bien reconocido daño de CA3 después de KA sistémico (29, 30). En los ratones tratados con solución salina, la microglía que expresa la molécula adaptadora de unión a calcio ionizada 1 (Iba1) se distribuyó uniformemente por todo el tejido del hipocampo, con procesos largos y delgados que se extendían desde el soma celular. Por el contrario, las células mieloides Iba1 + encontradas en ratones que entraron en SE mostraron un patrón muy diferente que consiste en agrupamiento celular alrededor de las neuronas dañadas y mostrando acortamiento y engrosamiento de sus procesos en cada punto de tiempo (Fig.1A). La tinción anti-proteína fluorescente roja (RFP) de secciones cerebrales adyacentes reveló un número sustancial de monocitos que expresan CCR2-RFP en el hipocampo de ratones SE 3 d después de SE, pero no en controles tratados con solución salina o en animales sujetos a KA en el Puntos de tiempo 1-d y 14-d (Fig.1A).

La pérdida de células del hipocampo y la microgliosis preceden a la infiltración de los monocitos CCR2 +. Los ratones macho CCR2-RFP de dos meses de edad recibieron KA intraperitoneal (30 mg / kg) o una inyección de control de solución salina y se sacrificaron 1, 3 o 14 días después. (A) Los ratones sujetos a KA mostraron pérdida de células neuronales en la región del hipocampo CA3 en todos los puntos de tiempo examinados. Esto fue acompañado por microgliosis, que fue robusta en el punto de tiempo de 3-d. La inmunohistoquímica anti-RFP reveló células CCR2-RFP + aisladas en los puntos de tiempo de 1 y 14 días. El punto de tiempo 3-d mostró una infiltración masiva de monocitos CCR2-RFP +. Se encontraron pocas células CCR2-RFP + en los animales tratados con solución salina. (Barra de escala: 100 μm.) (B) El análisis estereológico de las células Iba1 + del hipocampo total mostró un aumento de más del triple en los puntos de tiempo de 3 y 14 días. Hubo un aumento de aproximadamente el doble 1 día después de la inyección de KA (norte = 5 para cada condición ANOVA de una vía seguida de pruebas post hoc de Dunnett). (C) El análisis estereológico reveló aproximadamente 80.000 monocitos en el punto de tiempo 3-d en el hipocampo. El ANOVA seguido de las pruebas post hoc de Tukey reveló una diferencia significativa de monocitos CCR2-RFP + del hipocampo total entre 1 día y 3 días, así como entre 3 días y 14 días (***PAG & lt 0,001 norte = 5). (D) La mayoría de las células que expresan CCR2-RFP (rojo) también eran CD11b + (flechas verdes). Ocasionalmente se encontró una celda CCR2-RFP + CD11b - (punta de flecha). También se observaron microglía CCR2-RFP - CD11b + ramificada (asterisco). (Barra de escala: 50 μm.) (mi) Todos los ratones tratados con KA mostraron una puntuación de gravedad de las convulsiones de al menos 5.

El análisis estereológico de células Iba1 + en el hipocampo de ratones de control tratados con solución salina mostró aproximadamente 4,7 x 104 células. Un día después de SE, el número de células Iba1 + del hipocampo aumentó a 8,8 × 10 4 células, y aumentó aún más a 1,7 × 10 5 células en los puntos de tiempo 3-d y 14-d (Fig.1B). Encontramos solo una celda CCR2 + ocasional en los puntos de tiempo 1-d y 14-d. Por el contrario, se encontraron 8,0 × 10 4 CCR2 + monocitos en el hipocampo 3 d después de SE (Fig.1C). Por tanto, 3 d después de SE, había aproximadamente el mismo número de microglia y monocitos activados en el hipocampo.

Para verificar que las células CCR2-RFP + invasoras del cerebro son monocitos y no linfocitos, como las células T o las células asesinas naturales, investigamos los patrones de expresión del marcador mielomonocítico CD11b. Como era de esperar, las células que expresan CCR2-RFP eran predominantemente CD11b +, con pocos o ningún apéndice que se extendiera desde el soma celular (Fig.1D, flechas). CCR2-RFP +, CD11b: células que probablemente sean linfocitos T, solo se observaron en raras ocasiones dentro del infiltrado monocítico (Fig.1D, punta de flecha). Como era de esperar, también observamos células CD11b + con una morfología altamente ramificada, tipificada por numerosos procesos cortos que se extienden desde el soma celular, que no mostraban expresión detectable de CCR2-RFP (Fig.1D, asteriscos). Es probable que las células CCR2-RFP -, CD11b + altamente ramificadas sean microglias residente en el cerebro activadas. Dada la escasez de células T en la población CCR2 +, estos hallazgos proporcionan evidencia de que, además del daño neuronal y la inflamación, la EE inducida por KA también puede causar el reclutamiento de monocitos CCR2 + en el tejido del hipocampo. Además, el reclutamiento de monocitos no es un evento inmediato o temprano. Más bien, la infiltración de monocitos se produce entre 1 y 3 días después del inicio de la EE y, por lo tanto, se retrasa en relación con el inicio de la neurodegeneración y la activación microglial.

Expresión de CCL2 después de SE.

La quimiocina CCL2 es un ligando principal de CCR2 que recluta monocitos a los tejidos inflamados. Para identificar las células que expresan CCL2 en el cerebro, se sometieron ratones informadores transcripcionales CCL2 :: RFP a solución salina o KA (30 mg / kg) para inducir SE y se sacrificaron 1 o 3 días después. El uso de esta línea informadora transcripcional permite el etiquetado intracelular y la identificación de células que expresan Ccl2 ARNm (31). En particular, hubo poca tinción para CCL2 :: RFP en el hipocampo de ratones tratados con solución salina. Por el contrario, la tinción CCL2 :: RFP se encontró en el hipocampo de ratones 1 día después de SE, y la tinción CCL2 :: RFP se mejoró aún más 3 días después de SE (Fig.2A). Un día después de SE, observamos predominantemente dos estructuras celulares que expresan Ccl2 ARNm, que se asemeja a vasos sanguíneos o microglía altamente ramificada (Fig.2A, asteriscos rojos y B).

Las células mieloides parenquimatosas Iba1 + y los macrófagos perivasculares expresan CCL2 1 y 3 días después de la administración de kainato. Los ratones CCL2 :: mRFP recibieron KA (30 mg / kg, i.p.) o una inyección de control de solución salina y se sacrificaron 1 o 3 días después. (A) Los ratones sujetos a KA mostraron pérdida de células neuronales en la región del hipocampo CA3 en los puntos de tiempo examinados. La inmunohistoquímica anti-RFP reveló células CCL2-RFP + en los puntos de tiempo 1 y 3-d. En el punto de tiempo 3-d, se observan muchas microglías CCL2-RFP + en el hipocampo. (Barra de escala: 100 μm.) (B) Mayor aumento (paneles de ∼8 × en la Fig.2A) imágenes tomadas de las células en el punto de tiempo 1-d que revelan estructuras que se asemejan a los vasos sanguíneos (asterisco derecho, A) y microglía ramificada (asterisco izquierdo, A). (C) Imágenes representativas en 1 d que muestran Iba1 (microglia Cima), CD31 (células endoteliales Medio) y tinción de CD206 (macrófagos perivasculares) con señal CCL2-RFP. La microglía y los macrófagos perivasculares expresan CCL2. (Barra de escala: 25 μm.) (D) El análisis cuantitativo del hipocampo total CCL2 :: RFP + células mieloides (Iba1 +) en el hipocampo reveló un aumento significativo en el número de células doble positivas entre los puntos de tiempo 1-d y 3-d (tratados con solución salina, norte = 2 1-d, norte = 3 3-d, norte = 3 *PAG = 0.047, no apareado t prueba). Las barras indican la media ± SEM.

La tinción con Iba1 se colocalizó con la señal CCL2 :: RFP (Fig.2C). Además, detectamos células CCL2 :: RFP + asociadas con vasos sanguíneos cerebrales. Para determinar qué tipo de célula vascular expresaba el ARNm de CCL2, teñimos células endoteliales con anticuerpos contra CD31 (32) y usamos anticuerpos contra CD206 para teñir macrófagos perivasculares (33, 34), un tipo de célula mieloide que reside en el espacio perivascular. No hubo colocalización de CD31 endotelial y CCL2 :: RFP, pero observamos una fuerte colocalización de CD206 y CCL2 :: RFP (Fig.2C), lo que indica que los macrófagos perivasculares también expresaron CCL2. No se observó expresión de CCL2 en astrocitos o neuronas 1 d después de la EE. Estos hallazgos indican que la microglía y los macrófagos perivasculares expresan inicialmente CCL2 en el punto de tiempo 1-d después de SE, antes de la invasión de monocitos. El número de células mieloides Iba1 + que expresan CCL2 doblemente marcadas en el hipocampo aumentó de una célula doble positiva ocasional en ratones tratados con solución salina a 52 células por milímetro cuadrado de hipocampo 1 día después de SE inducida por KA, y 161 células por milímetro cuadrado 3 d después de SE (Fig.2D).

Ccr2 La deficiencia reduce el número de monocitos que se infiltran.

Interpretar las consecuencias fenotípicas de la EE en el Ccr2 rfp / rfp ratones knockout, primero comparamos la evolución temporal de las convulsiones conductuales en los deficientes y heterocigotos Ccr2 + / rfp ratones siguiendo KA. Encontramos que ambos genotipos desarrollaron convulsiones conductuales con intensidades y cursos de tiempo similares (Fig.3A). Tres días después de SE, examinamos de nuevo el tejido cerebral en busca de degeneración neuronal, microgliosis e invasión cerebral de monocitos CCR2 + circulantes. Tanto el daño neuronal como la activación microglial se encontraron en pacientes tratados con KA Ccr2 rfp / rfp ratones knockout y compañero de camada Ccr2 + / rfp control S. Sin embargo, el número de células Iba1 + y monocitos CCR2 + en los animales knockout CCR2 se redujo en comparación con los controles heterocigotos (Fig.3B). De hecho, el análisis estereológico de las células Iba1 + en el hipocampo de pacientes tratados con KA Ccr2 + / rfp Los ratones revelaron aproximadamente 1,7 × 10 5 células 3 días después de la EE, en comparación con ∼1,0 × 10 5 células en Ccr2 nocaut (Fig.3C). Además, el número de monocitos CCR2 + se redujo en 5,5 × 10 3 en el Ccr2 ratones knockout en comparación con los Ccr2 + / rfp animales (Fig.3D), apoyando la idea de que CCR2 media un papel importante en la infiltración de monocitos en el cerebro. Iba1 se expresa por los monocitos que invaden el cerebro, pero solo después de que los monocitos han entrado en el cerebro y han madurado (35), por lo que el número reducido de células mieloides Iba1 + en los ratones deficientes en CCR2 (Fig.3C) se puede explicar cuantitativamente por la pérdida de monocitos invasores (Fig.3D). Sólo en raras ocasiones se encontró que las células positivas para CCR2-RPF ingresaran al cerebro en el Ccr2 animales nocaut. Estas células fueron positivas para el marcador mielomonocítico CD11b, lo que indica que estas células eran monocitos (Fig.3mi) que presumiblemente se introdujeron en el cerebro en ausencia de señalización CCR2.

Ccr2 Los ratones knockout tienen un número reducido de células Iba1 + y monocitos CCR2-RFP + después de SE. Dos meses de edad Ccr2 + / rfp (norte = 5) y Ccr2 rfp / rfp (norte = 4) los ratones recibieron KA (30 mg / kg) y se monitorizó la gravedad de las convulsiones durante 5 h. Los ratones se sacrificaron 3 d después. (A) La gravedad de las convulsiones fue similar en los ratones knockout Ccr2 en comparación con los animales heterocigotos Ccr2 después de SE inducida por KA. (B) A los 3 d después de la EE, el examen histológico reveló que ambos genotipos mostraban daño neuronal en la región CA3 del hipocampo como se visualizaba con la tinción con violeta de cresilo, aunque el daño parecía menos pronunciado en el Ccr2 rfp / rfp ratones. El análisis de las secciones adyacentes mostró que la degeneración fue acompañada por la activación de la microglia Iba1 + en Ccr2 + / rfp y Ccr2 rfp / rfp ratones. Sin embargo, se observó una fuerte infiltración de monocitos que expresan CCR2-RFP sólo en el Ccr2 + / rfp ratones. (Barra de escala: 100 μm.) (C) El análisis estereológico de las células Iba1 + totales del hipocampo reveló una reducción de ~ 36% en el número de células Iba1 + en Ccr2 rfp / rfp ratones en comparación con Ccr2 + / rfp . (D) Los recuentos estereológicos de monocitos que expresan CCR2-RFP mostraron una fuerte reducción en el número de monocitos 3 d después de SE en el Ccr2 rfp / rfp ratones en comparación con Ccr2 + / rfp ratones sujetos a SE. Las barras indican la media ± SEM (*PAG = 0.025 y ***PAG & lt 0.001, sin emparejar t pruebas). (mi) La pequeña célula ocasional que expresa CCR2-RFP en el Ccr2 rfp / rfp el ratón era CD11b + (flechas verdes) y, por lo tanto, es probable que sea un monocito que ha sido llamado al cerebro por una señal que no requiere CCR2. Los asteriscos identifican las células CCR2-RFP -, CD11b +. (Barra de escala: 50 μM.)

La SE inducida por pilocarpina también causa infiltración cerebral de monocitos de una manera dependiente de CCR2.

Hasta ahora, nuestros experimentos han utilizado KA como agente quimioconvulsivo para causar SE. Para excluir que la infiltración de monocitos depende de KA como modelo de epilepsia, sometimos Ccr2ratones -suficientes y -deficientes a pilocarpina, otro agente quimioconvulsivo ampliamente utilizado, y mataron a los ratones 3 d después. A continuación, se examinaron las secciones de tejido del hipocampo en busca de monocitos que expresan CCR2-RFP. Como se esperaba, la señal CCR2-RFP no se detectó en el hipocampo de los pacientes tratados con solución salina. Ccr2 ratones heterocigotos (Fig.4A). Similar a los ratones tratados con KA, se observó una infiltración significativa de monocitos CCR2-RFP + en ratones heterocigotos CCR2 sujetos a SE inducida por pilocarpina (Fig.4B). Además, la infiltración de monocitos se redujo considerablemente en Ccr2 ratones knockout que experimentan SE inducida por pilocarpina (Fig.4C), en un grado similar observado en ratones tratados con KA (Fig.3 B y D). Estos hallazgos indican que los monocitos CCR2 + se infiltran en el cerebro después de la EE inducida por pilocarpina y demuestran que la dependencia de CCR2 de la infiltración de monocitos es independiente del agente quimioconvulsivo utilizado.

La infiltración de monocitos se reduce considerablemente en Ccr2 ratones knockout después de SE inducida por pilocarpina, y SE no cambia los niveles sanguíneos de leucocitos circulantes. Dos meses de edad Ccr2 + / rfp y Ccr2 rfp / rfp Los ratones se pretrataron con metilscopolamina (2 mg / kg, i.p.) y terbutalina (2 mg / kg, i.p.), y se inyectaron 20 minutos más tarde con clorhidrato de pilocarpina (280 mg / kg, i.p.) para inducir SE o solución salina. Se dejó que SE persistiera durante 1 h antes de ser interrumpido por diazepam (10 mg / kg, i.p.). Tres días después de SE, el examen histológico del tejido hipocampal reveló infiltración cerebral de monocitos CCR2-RFP + en Ccr2 + / rfp sujeto a pilocarpinaB), pero no en Ccr2 + / rfp animales que recibieron solución salina (A) o en Ccr2 rfp / rfp KO animales (C). (Barra de escala: 50 μm.) (D) Los valores sanguíneos de linfocitos (marcados como "L"), monocitos ("M") y neutrófilos ("N") no se alteraron entre el control tratado con solución salina y los ratones tratados con pilocarpina (norte = 6 por tratamiento). (mi y F) Se activaron células mieloides cerebrales aisladas de ratones con suficiente CCR2 en CD11b (mi) y dividido en poblaciones Ly6C baja y Ly6C alta (F). (GRAMO) La expresión de Ly6C se cuantificó en la población de CD11b + en ratones 4 d después de la EE. ANOVA unidireccional seguido de la prueba post hoc de Tukey reveló diferencias significativas entre los tratados con solución salina Ccr2 +/+ y tratados con pilocarpina Ccr2 +/+ ratones así como tratados con pilocarpina Ccr2 +/+ y Ccr2 KO animales (****PAG & lt 0,0001 norte = 5 por grupo). Las barras indican la media ± SEM.

Para examinar la posibilidad de que la aparición de monocitos en el cerebro después de la EE inducida por pilocarpina pueda atribuirse simplemente a un número elevado de monocitos que circulan en la sangre, se analizó la sangre completa para determinar los niveles en estado estacionario de linfocitos, monocitos y neutrófilos 3 d después de SE. En particular, la EE inducida por pilocarpina no cambió los niveles sanguíneos de ningún subtipo de leucocitos examinado, incluidos los monocitos (Fig.4D). Estos hallazgos indican que una acción sistémica de SE inducida por pilocarpina no altera el número de linfocitos, monocitos y neutrófilos circulantes.

Para obtener más información sobre las proteínas de diagnóstico expresadas por las células mieloides después de la EE, utilizamos la citometría de flujo. Además de CCR2, Ly6C también se expresa en niveles altos en monocitos reclutados en tejidos inflamados (11, 36). La población de células mieloides se identificó en el cerebro 4 días después de la EE utilizando CD11b (Fig.4mi). En estos estudios, Ly6C alto se utilizó para identificar los monocitos derivados de la sangre que se infiltran en el cerebro, mientras que Ly6C bajo identificó microglías residentes (Fig.4F). En los animales de control tratados con solución salina, solo el 2% de las células mieloides CD11b + expresaron niveles altos de Ly6C, en línea con el hallazgo de que los monocitos CCR2 + infiltrantes rara vez se encuentran en el cerebro no tratado, de modo que las microglias residentes en el cerebro representan el CD11b + predominante. población en el cerebro de control (Fig.4GRAMO). En comparación, 4 días después de SE, aproximadamente el 41% de las células mieloides CD11b + expresaron niveles altos de Ly6C, lo que confirma la conclusión basada en el recuento de células Iba1 + y RFP + en el modelo KA de que la microglía activada y los monocitos infiltrantes están presentes en aproximadamente iguales números 3–4 d después de SE. Finalmente, en marcado contraste con los animales con CCR2 suficiente que experimentan SE, los ratones knockout CCR2 tratados con pilocarpina mostraron una reducción del 99% en el porcentaje de células CD11b + con alto contenido de Ly6C, indistinguible de los controles con suficiente CCR2 tratados con solución salina (Fig.4GRAMO).

En conjunto, estos resultados proporcionan evidencia convincente de que las características fenotípicas del componente mieloide del cerebro se alteran sustancialmente después de la EE, donde las células mieloides que se infiltran en el cerebro expresan niveles altos de Ly6C, un marcador canónico de monocitos derivados periféricamente (37, 38). Además, la aparición de células mieloides con alto contenido de CD11b + Ly6C después de SE depende de CCR2.

La inducción de IL-1β después de SE se reduce en hipocampo pobre en monocitos.

Para obtener información sobre la contribución de los monocitos CCR2 + a la inflamación después de la EE, investigamos el perfil de expresión de un panel de mediadores inflamatorios en tipo salvaje y Ccr2 ratones knockout 4 días después de SE inducida por pilocarpina, cuando los monocitos CCR2 + se han infiltrado en el tejido del hipocampo (Fig. 4). Al igual que en los ratones tratados con KA, la administración de pilocarpina dio como resultado puntuaciones de gravedad de las convulsiones casi idénticas independientemente de Ccr2 genotipo (Fig.5A). Se realizó PCR cuantitativa en tiempo real (qRT-PCR) en tejido del hipocampo para medir los niveles de cinco mediadores inflamatorios que previamente se demostró que se inducían después de la EE (30, 39). Los niveles basales de ARNm de estos mediadores inflamatorios fueron casi idénticos en los de tipo salvaje y de tipo salvaje tratados con solución salina. Ccr2 animales knockout (Fig.5B). Los niveles de ARNm de los mediadores inflamatorios, iNOS, CCL2, TNF-α e IL-6, se indujeron todos en animales deficientes y suficientes en CCR2 a niveles casi idénticos. Sin embargo, la inducción de IL-1β se atenuó en ~ 50% en el Ccr2 animales knockout sujetos a SE inducida por pilocarpina en comparación con ratones de tipo salvaje (PAG = 0.028 Figura 5C).

Expresión de citocinas en hipocampo y células mieloides después de SE. (A) Después de la inyección de pilocarpina, la puntuación de convulsiones conductuales se tabuló cada 5 min hasta que la convulsión fue interrumpida por diazepam 1 h después del inicio de la EE en el tipo salvaje (norte = 14) y nocaut Ccr2 (norte = 11). (B) Los niveles basales del hipocampo de ARNm que codifican citocinas inflamatorias y mediadores fueron similares en los de tipo salvaje (norte = 6) y Ccr2 rfp / rfp (norte = 6) animales inyectados con solución salina. (C) La inducción del pliegue mediano de las citocinas inflamatorias y los mediadores en el hipocampo está representada por la línea horizontal y se traza para el tipo salvaje (norte ≥ 11) y eliminación de Ccr2 (norte ≥ 10) ratones 4 d después de SE. Cada símbolo representa un ratón individual, con la inducción referenciada a la media del grupo tratado con solución salina apropiado. (D) Los ratones se sometieron a SE inducida por pilocarpina durante 1 hora y se sacrificaron 4 días después. Se aisló ARNm de microglia baja CD11b + Ly6C clasificada por flujo (norte = 9) y monocitos de alta infiltración cerebral CD11b + Ly6C (norte = 5) y medido por qRT-PCR. Los cambios en el ARNm de la microglía activada por SE se normalizaron a la media de la microglía residente en el cerebro (norte = 5) de animales tratados con solución salina, mientras que los monocitos infiltrantes del cerebro después de SE se normalizaron a monocitos sanguíneos (norte = 5). La línea horizontal representa el pliegue medio de inducción de cada mediador inflamatorio. Cada símbolo representa una población de células mieloides preparadas a partir de un ratón individual. (mi) los cambios de ARNm de las células mieloides se normalizaron a la media de la microglía tratada con solución salina. Las barras indican la media ± SEM (*PAG = 0.028, **PAG & lt 0.01, ***PAG & lt 0,001 y ****PAG & lt 0,0001 por ANOVA unidireccional con prueba de comparaciones múltiples de Sidák).

El perfil inflamatorio de los subconjuntos de células mieloides.

Para evaluar la respuesta inflamatoria de la microglía residente en el cerebro y los monocitos que se infiltran en el cerebro, se examinaron los niveles de ARNm de las citocinas proinflamatorias IL-1β y TNF-α y la quimiocina CCL2 en poblaciones de células mieloides purificadas con FACS obtenidas del cerebro 4 días después de la EE. Se aislaron microglías y monocitos de homogeneizados cerebrales 4 d después de la EE basándose en su expresión diferencial de Ly6C y CD11b, en donde las microglías son CD11b + y exhiben niveles bajos de Ly6C, y los monocitos invasores del cerebro también son CD11b + pero con niveles más altos de Ly6C que microglía (Fig.4F).

En la microglía extraída del cerebro 4 días después de la EE, los niveles medios de ARNm de IL-1β fueron 16 veces más altos que en la microglía obtenida de ratones de control tratados con solución salina. Por el contrario, el nivel medio de IL-1β se elevó solo tres veces en los monocitos invasores del cerebro en comparación con los monocitos sanguíneos (PAG = 0,006 para la comparación del tipo de celda). También se indujo TNF-α en microglía y monocitos del cerebro SE. Los monocitos mostraron una menor inducción de TNF-α en comparación con la microglía (2,1 frente a 5 veces), pero esto no alcanzó significación estadística (PAG = 0.067) (Figura 5D). La inducción de ARNm de CCL2 fue aproximadamente la misma en monocitos (20 veces) y microglia (18 veces) (Fig.5D).

A continuación, normalizamos la expresión de citocinas en la microglía del cerebro SE, los monocitos invasores del cerebro y los monocitos sanguíneos a la de la microglía de los ratones de control tratados con solución salina. IL-1β y CCL2 fueron inducidas significativamente en microglia por SE (Fig.5mi). Curiosamente, los niveles de ARNm de IL-1β fueron 125 veces más altos en los monocitos sanguíneos circulantes que en la microglía de control, y los niveles de TNF-α fueron 486 veces mayores en los monocitos sanguíneos (Fig.5mi). Por lo tanto, los niveles de TNF-α fueron 79 veces mayores en los monocitos cerebrales después de SE en comparación con la microglía activada por SE (Fig.5mi). Estos hallazgos indican que la microglía y los monocitos responden de manera diferente al SE. Mientras que los monocitos muestran poca inducción de ARNm de IL-1β y TNF-α en respuesta a la SE y la entrada al cerebro, la microglía activada induce IL-1β y CCL2. Sin embargo, estos resultados también indican que la expresión de IL-1β y TNF-α en los monocitos circulantes es mucho mayor que la de la microglía activada.

CCR2 La deficiencia reduce la apertura de BBB inducida por SE.

La degradación de la BHE puede ocurrir después de lesiones cerebrales, incluidas convulsiones (6, 40, 41). La albúmina sérica se detectó mediante análisis de transferencia Western en la corteza perfundida con solución de PBS cuatro días después de la EE inducida por pilocarpina en ratones de tipo salvaje, en comparación con la albúmina mínima en animales de tipo salvaje tratados con solución salina (Fig. 6). Sorprendentemente, la extravasación de albúmina en la corteza casi se abolió en Ccr2 ratones knockout después de SE (Fig. 6). No hubo diferencias significativas en los niveles de albúmina en los ratones de tipo salvaje tratados con solución salina en comparación con los tratados con solución salina. Ccr2 ratones knockout. Estos hallazgos sugieren que la infiltración de monocitos en los días posteriores al SE exacerba aún más la filtración de BBB.

La integridad del BBB se mantiene en Ccr2 ratones knockout después de SE. (A) Extravasación de albúmina sérica en el cerebro 4 días después de que se usó pilocarpina SE para evaluar el daño a la BHE. Niveles de proteína de albúmina en homogeneizados corticales de control de tipo salvaje tratado con solución salina (norte = 6) y Ccr2-deficientenorte = 6) ratones y de tipo salvaje tratados con pilocarpina (norte = 18) y Ccr2-deficientenorte = 11) los ratones se midieron mediante transferencia Western con GAPDH como control de carga. Se muestran dos muestras representativas de cada grupo. (B) Intensidad de banda normalizada de la proteína de albúmina en relación con la de GAPDH y referenciada a la proporción media de albúmina / GAPDH en ratones de tipo salvaje. La relación logarítmica promedio de albúmina se comparó entre cada grupo experimental mediante ANOVA de una vía con prueba Sidák post hoc con pares seleccionados (*PAG = 0.043 y ***PAG & lt 0,001). Se representa gráficamente el cambio de veces normalizado al cambio de veces medio del grupo de tipo salvaje tratado con solución salina. Las casillas representan los percentiles 25/75. La línea horizontal en los cuadros representa el valor mediano.

CCR2 La ablación mejora la recuperación de peso y reduce el daño del hipocampo después de SE.

Anteriormente hemos demostrado que, durante las 24 h siguientes al EE, los roedores pierden rápidamente un 10-20% de su peso corporal y luego comienzan a recuperarse gradualmente en los días siguientes (6, 8, 39). Como era de esperar, los animales sujetos a EE perdieron 13% de su peso corporal en las 24 h posteriores al inicio de EE, independientemente de Ccr2 genotipo (Fig.7A). Entre 1 y 3 días después de la EE, los animales de ambos genotipos comenzaron a recuperar peso. Sin embargo, para el cuarto día, los ratones de tipo salvaje habían recuperado solo el 33% de su peso inicial perdido, mientras que el Ccr2 los ratones knockout habían mejorado significativamente más, recuperando el 61% de su peso inicial perdido (PAG & lt 0.05 el día 4 y PAG & lt 0.02 para la comparación de genotipos a lo largo de los días) (Fig.7A).

Aumento de peso acelerado y neuroprotección en Ccr2 KO después de SE. (A) Efecto de la deficiencia de CCR2 sobre el cambio de peso corporal del ratón después de pilocarpina SE (norte = 11-14 ratones por punto de tiempo, ANOVA bidireccional, interacción PAG = 0,274, tiempo PAG & lt 0.0001, genotipo PAG = 0,02, día 4 prueba post hoc de Bonferroni *PAG = 0.036). (B) La tinción con fluoro-jade B en secciones de tejido del hipocampo 4 d después de SE muestra más neuronas lesionadas en el subcampo CA3 de los ratones de tipo salvaje en comparación con los compañeros de camada knockout Ccr2. (Barra de escala: 100 μm.) (C) Un gráfico del número de células B + de fluoro-jade en las capas de células del hipocampo. Las barras indican la media ± SEM de cada grupo (*PAG = 0.016, no apareado t pruebas seguidas de la prueba de Holm-Sidák para comparaciones múltiples). (D) El número de neuronas piramidales de Fluoro-Jade B + por sección de hipocampo se representa para el tipo salvaje (norte = 14) y nocaut Ccr2 (norte = 11 *PAG = 0.018, no apareado t prueba). Cada símbolo representa el número medio de neuronas piramidales Fluoro-Jade B + por sección en cada ratón. (mi) Cuatro días después de SE, la tinción con fluoro-jade B y el marcado TUNEL se colocalizan en neuronas piramidales CA1 en tipo salvaje y Ccr2 ratones knockout. (Barra de escala: 50 μm.)

SE produce un patrón de pérdida de neuronas piramidales en roedores adultos que puede ser bastante variable de un animal a otro (29, 42). Evaluamos la neurodegeneración en hipocampos de tipo salvaje y Ccr2 ratones knockout 4 días después de SE inducida por pilocarpina. No se observó tinción con fluoro-jade B en el hipocampo de los ratones tratados con solución salina (Fig. S1). Aunque SE indujo tinción con Fluoro-Jade B de neuronas lesionadas en el hipocampo en ratones de tipo salvaje y deficientes en CCR2 (Fig.7B), el número de neuronas Fluoro-Jade B + se redujo en los subcampos CA1 y CA3, así como la región hiliar de la circunvolución dentada en el knockout CCR2 (Fig.7 C y D). En promedio, se contaron 130 neuronas CA3 teñidas por sección en ratones de tipo salvaje, mientras que se identificaron 69 neuronas teñidas en animales que carecen de CCR2 (PAG & lt 0,05). Asimismo, cuando se comparó el número total de neuronas piramidales del hipocampo de Fluoro-Jade B + (CA1 + CA3) entre los dos genotipos, se observó una reducción significativa del 50% en las neuronas dañadas (Fig.7D) en el Ccr2 ratones knockout. Las neuronas Fluoro-Jade B + se etiquetaron con la señal TUNEL en ratones de tipo salvaje y deficientes en CCR2 (Fig.7mi), de acuerdo con nuestros hallazgos previos (9). En los ratones de tipo salvaje, encontramos que el 93% de las neuronas piramidales Fluoro-Jade B + CA1 y CA3 eran TUNEL +, y también el 92% de las neuronas piramidales Fluoro-Jade B + en el Ccr2 los ratones knockout fueron TUNEL +. No se encontró tinción TUNEL en ratones knockout y con suficiente CCR2 tratados con solución salina (Fig. S1). No encontramos evidencia de tinción de caspasa-3 escindida en cinco secciones de hipocampo de cada uno de tres ratones 4 días después de la EE inducida por pilocarpina o en secciones de un ratón muerto 24 h después de la EE (Fig. S2). A pesar de la ausencia de tinción de caspasa-3 escindida en el hipocampo, encontramos la señal de caspasa-3 escindida en el músculo esquelético dañado, de acuerdo con informes anteriores (43).

Ausencia de tinción con fluoro-jade B y neuronas piramidales del hipocampo TUNEL + en el tipo salvaje tratado con solución salina y Ccr2 animales nocaut. (A) La tinción con fluoro-jade B en secciones de tejido del hipocampo de ratones tratados con solución salina no muestra neuronas lesionadas en el subcampo CA3 de los ratones deficientes y suficientes en CCR2. (Barra de escala: 100 μm.) (B) Las tinciones con fluoro-jade B y TUNEL están ausentes en las neuronas CA1 en ratones deficientes y suficientes en CCR2 tratados con solución salina. (Barra de escala: 100 μm.)

Ausencia de inmunorreactividad de caspasa-3 escindida en neuronas piramidales del hipocampo después de la pilocarpina. Como control positivo, el músculo esquelético dañado muestra una tinción de caspasa-3 escindida 7 días después de la lesión. Por el contrario, 4 días después de la EE inducida por pilocarpina, no se detecta ninguna señal de caspasa-3 escindida en el hipocampo. (Barra de escala: 100 μm.)

Estos resultados revelan que la ausencia de CCR2 acelera la recuperación de la pérdida de peso, protege contra la degradación de la BBB y proporciona una neuroprotección significativa en el modelo de pilocarpina de SE. Además, dado que la deficiencia de CCR2 limita enérgicamente la invasión de monocitos transmitidos por la sangre en el cerebro, nuestros hallazgos sugieren que la infiltración de monocitos CCR2 + exacerba el daño neuronal y las consecuencias inflamatorias de la EE.


Materiales y métodos

Animales

En este estudio, utilizamos ratones C57BL / 6 machos de 8-12 semanas de edad de Taconic (Dinamarca). Todos los experimentos fueron aprobados por la Inspección de Experimentos con Animales de Dinamarca.

FACS de células CPE

Los ratones se anestesiaron mediante inhalación de isoflurano y se sacrificaron mediante dislocación cervical. El plexo coroideo (CP) de todos los ventrículos del cerebro se extrajo y se colocó en solución salina tamponada con HEPES (HBS) en hielo (Tabla 1).Se incubaron tejidos de CP agrupados de 6 a 8 ratones en 50 μg / mL de fluoresceína de concanavalina A (Vector Laboratories) en HBS durante 10 min a 37 ° C, digerida en 4 μg / mL de dispasa (Invitrogen) y 4 μg / mL de colagenasa B (Roche) en HBS sin calcio durante 30 min a 37 ° C, y se incubó en una mezcla 1: 1 de TrypLE Select Enzyme (Thermo-Fisher) y cultivo celular con tripsina / EGTA (Thermo-Fisher) suplementada con 1 mg / ml de ADNasa (Sigma) durante 10 min a 37 ° C. La preparación se pasó a través de un 50-μm, y se añadió yoduro de propidio antes de la clasificación de células activadas por fluorescencia (FACS) para la exclusión de las células muertas. Las células se clasificaron en muestras positivas para fluoresceína y negativas para fluoresceína mediante clasificación de pureza de 4 vías en un FACS Aria III (BD Biosciences). Las celdas se clasificaron utilizando un 70-μboquilla m, a 70 psi y 12-20 kHz. Después de FACS, las muestras, así como las muestras de CP de control, se centrifugaron durante 1 minuto en una microcentrífuga de mesa y los sedimentos se procesaron para el aislamiento total del ARN. La pureza de la muestra se validó mediante RT-PCR con cebadores dirigidos al marcador epitelial Claudin-1 (Cldn1) y el marcador endotelial Claudin-5 (Cldn5).

Componente HBS 0Na + -HBS NUEVA HAMPSHIRE4Cl HBS Alto contenido de K + HBS BBS
Na + 145.0 0.0 125.0 10.0 145.0
K + 3.6 3.6 3.6 138.6 3.6
Ca 2+ 1.8 1.8 1.8 1.8 1.8
Mg 2+ 0.8 0.8 0.8 0.8 0.8
NUEVA HAMPSHIRE4 + 0.0 0.0 20.0 0.0 0.0
NMDG 0.0 145.0 0.0 0.0 0.0
Cl - 138.6 138.6 138.6 138.6 114.6
ASI QUE4 2− 0.8 0.8 0.8 0.8 0.8
correos4 2− 2.0 2.0 2.0 2.0 2.0
HCO3 0.0 0.0 0.0 0.0 24.0
HEPES 10.0 10.0 10.0 10.0 10.0
Glucosa 5.5 5.5 5.5 5.5 5.5
pH 7.4 7.4 7.4 7.4 7.4

Transcripción inversa: reacción en cadena de la polimerasa (RT-PCR)

Se homogeneizó tejido de ratón en reactivo TRI (Ambion) y se purificó el ARN total utilizando el kit RiboPure ™ (Ambion). Las muestras de ARN se trataron con ADNasa (Invitrogen) y se llevó a cabo la síntesis de ADNc, utilizando el sistema de transcriptasa inversa SuperScript II (Invitrogen). Las muestras RT negativas sirvieron como control interno para el tratamiento con DNasa. La PCR se realizó en un ciclador térmico DNA Engine DYAD Peltier (MJ Research) con desnaturalización inicial a 95 ° C durante 15 min, seguida de 30-35 ciclos de amplificación que constan de 30 segundos de desnaturalización a 95 ° C, 30 segundos de hibridación a 58 –60 ° C y 30 segundos de alargamiento a 72 ° C (consulte la Tabla 2 para ver las secuencias de los cebadores y los tamaños de los productos).

Proteína Gene Imprimación directa Imprimación inversa Pares de bases
β-actina Actb ACTGAGCTGCGTTTTACACCC ACACAGAAGCAATGCTGTCACC 446
V-ATPasa A Atp6v1a CCAATCACCCCTTGCTTAC TCTACTTTCCCATCAACCTCC 241
V-ATPasa B1 Atp6v1b1 AAACTACATCACCCACCCC GCCAGAGCCATTGAAAATCC 298
V-ATPasa B2 Atp6v1b2 CAAACCCTACCTCTCAACTCC ACGCAGAAACCGAAACCAC 466
V-ATPasa C1 Atp6v1c1 CCAAGCTGAACCACAATGAC ATCCACGCAATAAACGCC 316
V-ATPasa C2 Atp6v1c2 AAGGGGAAAGCACACGAGAC CTTGACTTGGGGACGATGAC 359
V-ATPase a4 Atp6v0a4 CGACTACGATGACTCTTCCAAC AATTCCACCCAATGCAGCC 552
V-ATPasa d1 Atp6v0d1 CGCTTTCATCATCACCATCAAC ACAATCCCAGGACAATGCTAC 509
V-ATPasa d2 Atp6v0d2 AAAGCCAGCCTCCTAACTC CTTGCAGAATTTGTAGAATGCC 525
Claudin 1 Cldn1 AGGTGCAGAAGATGTGGATGGC AGAGGGAAGCAGCAGTTCACAG 527
Claudin 5 Cldn5 AATCAATTCCCAGCTCCCAGCC TGAGTGCTACCCGTGCCTTAAC 443
AC soluble 1 Adcy10 TGCATCTGAAATGTGCCCGC TTTCAGCAGCCTTTCTCCCTCG 503
AC soluble 1 Adcy10 TTTGCAGGTGATGCCTTGCTG TCATGCTCCGATCACAGAGCTG 319

Anticuerpos

Un anticuerpo V-ATPasa purificado por afinidad generado en conejo contra la subunidad A de 70 kDa de la proteína (Hurtado-Lorenzo et al.2006) y un anticuerpo monoclonal de ratón generado contra sAC (Zippin et al.2003) se utilizaron en la estudio. IgG anti-conejo de burro conjugado con Cy3 (Jackson ImmunoResearch Laboratories) o anticuerpos Alexa 488 anti-conejo de burro (Invitrogen) e IgG anti-ratón de burro conjugado con isotiocianato de fluoresceína (FITC) (Jackson ImmunoResearch Laboratories) se utilizaron como anticuerpos secundarios.

Inmunotransferencia

El riñón de ratón se homogeneizó en tampón de disección helado (0,3 mol / L de sacarosa, 25 mol / L de imidazol, 1 mmol / L de ácido etilendiaminotetraacético (EDTA), pH 7,2 que contenía 8,4 μmol / L de leupeptina (Calbiochem), 0,4 mmol / L de Pefabloc [Roche]) y centrifugado a 4000 gramo durante 15 min a 4 ° C. Se añadió tampón de muestra al sobrenadante (concentración final: dodecilsulfato de sodio 0,1 mol / L y ditiotreitol 0,04 mol / L), pH 6,8. El plexo coroideo disecado se disolvió directamente en tampón de muestra y se sonicó mediante 5 ráfagas 3 veces al 60% de potencia usando un sonicador Modelo 150 V / T (BioLogics Inc.). Las muestras de proteína se calentaron a 65ºC durante 15 min y las proteínas se separaron mediante electroforesis en gel de poliacrilamida al 12,5% y se transfirieron eléctricamente a una membrana de PVDF (Ambion). Las membranas se bloquearon con leche al 5% en PBS-T (0,1 mol / L de PBS (en mmol / L: 167 Na +, 2,8 H2correos4 -, 7,2 HPO4 2-, pH 7,4) con 0,1% vol / vol Tween), y se incubó durante la noche a 5 ° C con anticuerpo primario en PBS con 1% de albúmina de suero bovino (BSA) y 2 mmol / L de NaN3. Después de enjuagar, las transferencias se incubaron con anticuerpo secundario anti-conejo conjugado con peroxidasa de rábano picante (Dako) y se obtuvieron imágenes (ImageQuant LAS4000, GE Healthcare).

Preparación de tejidos e inmunotinción

Los ratones se anestesiaron mediante inhalación de isoflurano y se fijaron en perfusión con paraformaldehído (PFA) al 4% en PBS durante 4 minutos a través del ventrículo cardíaco izquierdo. Los cerebros se extrajeron y el poste de inmersión se fijó en PFA al 4% en PBS durante 1 hora a 4ºC.°C. Los tejidos se enjuagaron en PBS y se deshidrataron en concentraciones crecientes de etanol (70%, 96% y 99%, 2 h en cada uno) antes de colocarlos en xileno durante la noche. Los tejidos se infiltraron con parafina durante 1 ha 60 ° C. 2-μSe cortaron secciones de m en un micrótomo (RM 2165 Leica Microsystems).

Los portaobjetos de tejido se desparafinaron en xileno, se rehidrataron en concentraciones decrecientes de etanol (99%, 96% y 70%) y se aclararon en PBS. Para la recuperación del antígeno, los portaobjetos se trataron con SDS al 1% (p / v) en PBS durante 4 min y se lavaron en PBS. Las secciones se bloquearon con albúmina de suero bovino al 1% (p / v) en PBS que contenía azida sódica al 0,02% durante 20 min y se incubaron con anticuerpo primario durante 90 min a temperatura ambiente. Los portaobjetos se lavaron en PBS, se incubaron con anticuerpo secundario durante 60 min a temperatura ambiente, se lavaron nuevamente y se montaron con cubreobjetos utilizando medio de montaje Vectashield (Vector Laboratories Inc.) que contenía DAPI, o se incubaron con tinción nuclear Topro3 (Invitrogen) antes de montar con glicergel anti -desvanecerse (Dako). Se utilizó un microscopio de epifluorescencia 80i (Nikon Instruments) equipado con una cámara CCD Orca 100 (Hamamatsu) o un microscopio confocal invertido DM IRE2 (Leica Microsystems) para adquirir las imágenes digitales.

Análisis de la distribución celular de V-ATPasa

La cuantificación de la distribución de V-ATPasa se realizó mediante exploración de líneas (software ImageJ, Institutos Nacionales de Salud) a través de células con un núcleo visible. La línea era perpendicular a la membrana basal y se expandió a una banda con un ancho de 21 píxeles y se colocó en el plano nuclear medio de cada célula que contiene un núcleo en todas las imágenes (2-8 imágenes por ratón). El número de contenedores (puntos de medición) se comprimió a 50 (o 40, en la Fig.5) para cada celda y se calculó la intensidad de tinción promedio para cada contenedor para cada uno de los diez ratones, donde el contenedor # 1 representa el final basal de las celdas. En el extremo luminal, lo más probable es que los últimos 5 contenedores representen el borde del cepillo. Para corregir la tinción de fondo, se restó la intensidad de tinción más baja de cada ratón de cada uno de los otros contenedores del mismo ratón. Después de esto, se calculó la intensidad de tinción promedio para cada uno de los 50 (o 40) contenedores para todas las células nucleadas para cada ratón y se promedió para cada grupo de 5 ratones (ratones tratados con hipertermia y ratones de control).

Microscopía electrónica de inmunogold

El plexo coroideo que se fijó con paraformaldehído al 4% en PBS (NaCl al 0,9% en tampón fosfato 10 mmol / L, pH 7,4) se deshidrató a través de una serie de etanol graduado a etanol al 100% y posteriormente se infiltró, incrustó y polimerizó en resina LR White. (EMS) a 50 ° C como se describió anteriormente (Paunescu et al. 2010). Se cortaron secciones delgadas del plexo coroideo en secciones de aproximadamente 70 nm en un ultramicrótomo EM UC7 (Leica Microsystems) y se recogieron en rejillas recubiertas de formvar. Las rejillas se hicieron flotar sobre gotas de anticuerpo primario de la subunidad anti-V-ATPasa A de conejo diluido 1:50 en diluyente de anticuerpos (Dako) durante 2 horas a temperatura ambiente, se enjuagaron con gotas de PBS y se hicieron flotar sobre gotas de IgG anti-conejo de cabra. anticuerpo acoplado a partículas de oro de 15 nm diluidas 1:15 en diluyente de anticuerpos durante 1 ha temperatura ambiente. Las rejillas se aclararon, se tiñeron posteriormente en gotas de acetato de uranilo al 2% durante 5 min, se aclararon y se secaron. Las secciones del plexo coroideo se examinaron en un microscopio electrónico de transmisión JEM-1011 (JEOL) a 80 kV. Las imágenes se adquirieron utilizando un sistema de imagen digital AMT XR60 (Advanced Microscopy Techniques).

PH intracelular (pHI) mediciones

Los experimentos se realizaron como se describió anteriormente (Damkier et al. 2009). Los tejidos de CP aislados se digirieron en grupos de células de una sola capa por 4 μg / mL de dispasa (Invitrogen) y 4 μg / mL de colagenasa B (Roche) en HBS sin calcio (Tabla 1) a 37 ° C durante 30 min. Los grupos de células digeridos se montaron en cubreobjetos recubiertos con Cell-Tak (BD Biosciences) durante 10-15 min a 37 ° C y se cargaron durante 10 min con la sonda sensible al pH BCECF-AM (2 μmol / L, Invitrogen). Los cubreobjetos se montaron en una cámara de perfusión cerrada (aparato de Harvard RC-21BR) y se colocaron en una platina de microscopio invertida dentro de una caja oscura a 37 ° C. Se permitió que las células se equilibraran a un nivel de línea base en HBS antes de la acidificación celular mediante un NH4Cl prepulso durante 3-5 min (NH4Cl HBS, Tabla 1) seguido de HBS libre de Na + (0Na + HBS, Tabla 1). Cada experimento se concluyó con una calibración de un punto en pH 7.0, alto K + HBS (Tabla 1) que contenía 10 μmol / L de nigericina.

Se utilizó el software Till Vision (Till Photonics) para controlar la longitud de onda del monocromador alternando entre 490 nm y 440 nm, el tiempo de exposición (20 ms), la frecuencia (1 Hz) y el binning (hasta imágenes de 512 × 512 píxeles). La emisión de luz a 510-535 nm se registró con una cámara CCD monocromática refrigerada de 12 bits (QImaging, Retiga EXi) y se recopilaron datos de las regiones de interés definidas por el usuario (ROI) de las células individuales después de la sustracción de fondo. La relación de fluorescencia (490/440 nm) se calibró a pH sujetando el pHI paso a paso desde pH 8–6 en HBS alto en K + con 10 μmol / L de nigericina (Boyarsky et al. 1988). La tasa de pHI recuperación (dpHI/ dt) se determinó como el pHI cambio en 30 segundos después del pico de pH mínimoI.

Medida del potencial de membrana (Vmetro) en células CPE aisladas

Los grupos aislados de CPEC se sembraron en placas de cultivo recubiertas con Cell-Tak (BD Biosciences) (Falcon, Becton Dickson) que contenían HBS. Se permitió que las células aisladas y pequeños trozos de epitelio se adhirieran al fondo de la cámara durante 15 minutos antes de la grabación de Vm (Kotera y Brown 1994). Todos los registros se realizaron a temperatura ambiente con pipetas de parche de vidrio de borosilicato (Aparato Harvard) con resistencias en el rango de 2 a 5 MΩ. Las grabaciones se realizaron con un amplificador Axopatch 200B (Axon Instruments Inc., CA) cambiando del modo de pinza de tensión a pinza de corriente. Primero, se estableció una configuración de celda completa en modo de pinza de voltaje (resistencia de sellado y resistencia de acceso gt1 GΩ 5–10 MΩ) y luego se cambió inmediatamente al modo de pinza de corriente para detectar Vm. El Vm detectado inmediatamente después de establecer la configuración de la célula completa (en no más de 1 min) se registró para análisis adicionales. La solución de pipeta en estos experimentos contenía (en mM): 140 K +, 4 Na +, 2 Mg 2+, 120 aspartato, 24 Cl -, 2 ATP 2-, 0.5 EGTA, 5 HEPES y ajustada a pH = 7.4, mientras que HBS se utilizó como solución de baño.

Alcalosis respiratoria (hipocapnia) por hipertermia e hipoxia

Para la hipertermia, se utilizó una lámpara de calentamiento para aumentar la temperatura de un recipiente a 42 ° C. Los ratones se colocaron en el recipiente individualmente durante 5-7 min, induciendo así hiperventilación y provocando lavado de CO2 antes de que se indujera la anestesia con isoflurano. Los controles se colocaron en la cámara durante la misma cantidad de tiempo pero a temperatura ambiente. Para la hipoxia, los ratones se colocaron dentro de una cámara que contenía una mezcla de gas de 12% de O2 en 88% N2 durante 5 min antes de la inducción de la anestesia con isoflurano en la misma mezcla de gases. Los ratones de control inhalaron aire normal. Para ambos experimentos, se extrajeron muestras de sangre de la aurícula derecha del corazón y los ratones se fijaron por perfusión con PFA al 4% en PBS a través del ventrículo izquierdo. La sangre se analizó en un analizador de gases en sangre ABL80 Flex (Radiometer).

Inyección estereotáctica de AMPc en ventrículos cerebrales de ratones

Los ratones se anestesiaron mediante una inyección intraperitoneal en bolo de ketamina (100 mg / kg) y xilazina (10 mg / kg) seguida de inyecciones continuas de dosis más pequeñas de anestesia según fuera necesario. Cada ratón se colocó en un equipo estereotáctico (David Kopf Instruments) y se insertó una jeringa Hamilton de 2,5 mm a través del cráneo en los ventrículos laterales en las coordenadas 0,8 mm lateral y 0,1 mm caudal al bregma. Un volumen de 5,5 μSe inyectó lentamente L 10 mmol / L de 8-CPT-cAMP (Sigma-Aldrich) o vehículo (CSF artificial / aCSF, Alzet) (0,5 μL / min). Después de 30 min, el ratón se fijó por perfusión y el cerebro se sometió a inmunohistoquímica.

Estadísticas

Valores medios de pHI La tasa de recuperación se comparó mediante ANOVA no paramétrico con la prueba posterior de Dunnet, ya que los datos no pasaron la prueba de normalidad. Las intensidades de tinción de V-ATPasa y los valores de gases en sangre se analizaron mediante una prueba t de dos colas. Para todos los análisis, PAG & lt 0,05 se consideró significativo.


Materiales y métodos

Tipo de reactivo
(especie) o
recurso
DesignacionFuente o
referencia
IdentificadoresAdicional
información
Colar, colar el fondo (Mus musculus)ShhCre / +Liu y col., 2010Laboratorio Jacksonnúmero de inventario: 005622
Colar, colar el fondo (Mus musculus)Atoh1-CreER +Chow y col., 2006MMRRCnúmero de inventario: 029581-UNC
Colar, colar el fondo (Mus musculus)vGlut3-iCreER / +Li et al., 2018Disponible a pedido de Liu LabPóngase en contacto con ([email protected])
Colar, colar el fondo (Mus musculus)Scrt2-P2A-tdTomato / +Es una línea de ratón knockin donde tdTomato puede reflejar Scrt2 patrón de expresión de ARNmLaboratorio Jacksonstock #: 034390 (será depositado pronto)
Colar, colar el fondo (Mus musculus)Celf4-3xHA-P2A-iCreER-T2A-EGFP / +Es una línea de ratón knockin donde HA está marcado en el extremo terminal de la proteína C de Celf4. Además, iCreER y EGFP están controlados por Celf4 promotor / potenciadorLaboratorio Jacksonstock #: 034391 (será depositado pronto)
Kit de extracción de ARNKit de aislamiento de ARN PicoPureThermo ScientificNo de catálogo: KIT0204Extrayendo ARN de células aisladas
kit de generación de ADNcOvation RNA-Seq V2Tecan GenomicsN. ° de gato: 7102–32Conversión de ARN en ADNc
Kit de construcción de bibliotecaSistema multiplex de Ovation Rapid DRTecan GenomicsN. ° de gato: 0319–32Generación de biblioteca de secuenciación con multiplexación de ocho muestras
Enzima digestivaProteasaSigmaNo de gato: P5147Digestión de los tejidos del oído interno

Marcaje genético y controles de calidad previos y posteriores a la secuenciación de SGN, HC y células gliales, y construcción de bibliotecas

Los SGN de ​​diferentes edades se seleccionaron manualmente para garantizar la máxima pureza de nuestras muestras. La recolección manual nos permitió no solo monitorear la fluorescencia del tdTomato, la morfología y la salud de las células, sino también evitar la recolección de desechos celulares. Las células recogidas se lavaron tres veces, para maximizar la pureza de la muestra, antes de cargarlas en el tampón de lisis. También utilizamos la selección manual para una población de células de referencia, las células gliales P8. Inicialmente intentamos usar FACS para obtener células gliales, pero la pureza de estas células no cumplía con nuestros criterios de calidad. En el caso de la segunda población de células de referencia, P12 HC (tanto coclear como vestibular), las muestras obtenidas mediante FACS cumplieron con nuestros criterios de calidad y, por tanto, se utilizaron.

Se utilizaron tres modelos genéticos para marcar cada tipo de célula con tdTomato. Los SGN se marcaron genéticamente con tdTomato utilizando ShhCre / + Rosa26-CAG-loxp-stop-loxp-tdTomato / + tensión (Figura 1). Después de la microdisección, los tejidos cocleares se examinaron con un microscopio de fluorescencia para determinar si las células tdTomato + estaban limitadas a la región SGN. ShhCre / +: la fuga hace que todas las células del oído interno se conviertan en tdTomato +. Los HC se marcaron genéticamente con tdTomato utilizando Atoh1-CreER + Rosa26-CAG-loxp-stop-loxp-tdTomato / + ratones a los que se les administró tamoxifeno en P0 y P1 (Chow et al., 2006). Por último, las células gliales y las IHC cocleares se diseñaron para expresar tdTomato + utilizando vGlut3-iCreER / + Rosa26-CAG-loxp-stop-loxp-tdTomato / + ratones a los que se les administró tamoxifeno en P2 y P3 (Li et al., 2018), y solo se disecaron los tejidos en el área de SGN para descartar tdTomato + IHC. Seguimos los mismos protocolos de digestión de tejidos y selección de células que se describieron anteriormente (Li et al., 2018 Liu et al., 2015). Se utilizó el kit de aislamiento de ARN PicoPure (KIT0204, Thermo Scientific) para extraer el ARN. Se utilizaron Ovation RNA-Seq V2 (7102–32, Tecan Genomics) y Ovation Rapid DR Multiplex System (0319–32, Tecan Genomics) para la conversión de ADNc y la construcción de bibliotecas.

El control de calidad previo a la secuenciación se realizó utilizando qPCR. Mafb, Sox10, y Miosina-VI se seleccionaron como genes específicos para SGN, glía y HC, respectivamente, y el criterio aplicado fue que para cada tipo de célula, la muestra debe presentar un enriquecimiento o agotamiento de al menos 30 veces en Mafb, Sox10, y Miosina-VI, como se ejemplifica en P8 SGN (Figura 1D-1F). Los datos de qPCR se analizaron estadísticamente utilizando Student's t prueba. El archivo complementario 2 incluye las secuencias del cebador qPCR para cada gen. El control de calidad posterior a la secuenciación se realizó utilizando genes conocidos adicionales para verificar la calidad y pureza de las células. Además de SGN, HC y marcadores gliales, evaluamos genes que cubren otros siete tipos de células: neuronas inhibidoras, neuronas catecolaminérgicas, oligodendrocitos, astrocitos, microglía, células del plexo coroideo y células sanguíneas, así como genes de mantenimiento (Figura 2 - Figura 2 ). En nuestro estudio solo se incluyeron las muestras que pasaron los puntos de control tanto previos como posteriores a la secuenciación. Todos los ratones se criaron y criaron en habitaciones para animales con nivel de protección solar, y los procedimientos con animales se realizaron de acuerdo con las directrices (NA-032-2019) de la IACUC del Instituto de Neurociencia (ION) de la Academia de Ciencias de China.

Análisis computacional de datos de RNA-Seq

Las lecturas de RNA-Seq en archivos FASTQ se asignaron al genoma mm10 del ratón utilizando STAR (Dobin et al., 2013). Las lecturas mapeadas se cuantificaron luego con featureCounts (Liao et al., 2014) utilizando la anotación gencode.vM15 del ratón (Harrow et al., 2012). Se calcularon las expresiones diferenciales por pares entre grupos: genes que presentan valores CPM (recuentos por millón) de & gt1 para todas las réplicas en al menos un grupo se seleccionaron para ser considerados para el análisis posterior (21,293 de 52,550, incluyendo HC y glia, o 17, 531 excluyendo HC y glia).

Para filtrar los genes específicos de SGN que muestran expresión constante o dinámica (Figura 2A y B), los datos de recuento se normalizaron TMM (la media ponderada recortada de los valores M) y se evaluaron las expresiones diferenciales por pares para todos los pares de grupos utilizando el paquete limma con su método voom (Law et al., 2014). Primero, los genes específicos de SGN que muestran expresión constante se definieron como genes en la intersección de estas cuatro condiciones (Figura 2A): 1) expresados ​​diferencialmente entre todos los SGN y HC, glia (con cambio de veces, FC & gt 4 y qval & lt0.01) 2) no expresado diferencialmente entre SGN a diferentes edades (FC & lt 2), 3) los valores de TPM (transcripciones por millón) en las poblaciones de HC y glia eran & lt5 4) el valor medio de TPM en SGN era & gt30. En segundo lugar, los genes específicos de SGN que muestran expresión dinámica se extrajeron de acuerdo con las siguientes condiciones (Figura 2B): 1) se encontró una diferencia significativa entre al menos uno de los grupos de SGN y tanto HC como glia (qval & lt0.01 y FC & gt 4 ) 2) hubo una diferencia significativa en al menos una comparación pareada entre diferentes grupos de SGN (qval & lt0.05 y FC & gt 2) 3) el TPM medio máximo del grupo SGN fue & gt75 4) el TPM medio máximo del grupo SGN fue de al menos 25 veces tanto como el de HC y glia. El uso de criterios relativamente menos estrictos debería resultar en la identificación de genes específicos de SGN adicionales que muestran patrones de expresión constantes o dinámicos.

También analizamos la dinámica de los genes SGN (CPM & gt 10 para todas las réplicas en al menos una edad de 9349 genes) sin considerar sus patrones de expresión en HC y glia (Figura 3). Para clasificar la dinámica de los genes, se designan como regulados al alza (u), regulados a la baja (d) o sin cambios (-), entre una edad y la siguiente (por ejemplo, SGN_E15.5 a SGN_P1). La regulación hacia arriba o hacia abajo se determina en función de estos valores: qval & lt0.05 y FC & gt2. Sin cambios se determina en función de qval & gt0.1, FC & lt2 y FC & lt4 máxima por elemento. Todos los demás genes alterados fueron designados como "ruidosos". Por simplicidad, los genes ruidosos se incluyeron en el grupo sin cambios (Figura 3B). La dinámica para todo el período se clasificó como la combinación de las transiciones individuales (por ejemplo, 'u --- "indica regulación ascendente de E15.5 a P1, seguida de una expresión sin cambios de P1 a P8, P8 a P14 y P14 a P30). Tenga en cuenta que la dinámica aquí se centró en los cambios entre dos edades vecinas (Figura 3C-J). Esto difiere de la dinámica en el contexto de genes específicos de SGN que muestran patrones de expresión dinámica, que se definieron como genes que exhibieron significativamente diferentes expresión entre cualquiera de las dos edades comparadas (Figura 2B). Debido a esta diferencia, Celf4 pertenecía a la categoría sin cambios (----) (Figura 3B). Sin embargo, Celf4 La expresión en la edad adulta (P30) fue significativamente mayor que en E15.5 (Figura 2C), como también fue validado por el análisis qPCR de Celf4 (Figura 2D). Por lo tanto, Celf4 se definió como un gen específico de SGN que muestra expresión dinámica (Figura 2B). Los patrones dinámicos de cada gen (Figura 3B-J) se describieron en el archivo complementario 1.

Por último, para encontrar qué tipo de genes pertenecen a cada uno de los grupos clasificados anteriormente, se realizaron análisis de enriquecimiento de genes (Figura 3K-M) para cada grupo de genes dinámicos utilizando 1) los grupos de genes HUGO de nivel superior (Braschi et al., 2019 ), 2) Sistema de clasificación PANTHER (Mi et al., 2017), y 3) el componente de Función Molecular de la Anotación de Ontología Genética (Ashburner et al., 2000). Enriquecimiento pag-El valor se calculó mediante distribución hipergeométrica. Todos los datos brutos de nuestro RNA-seq se han depositado en GEO (Gene Expression Omnibus) con el acceso: GSE132925. Los recuentos de lectura de todos los genes están disponibles en el archivo: GSE132925-cochlear-SGN-cnts.txt.gz adjunto en GEO.

Generación de Scrt2-tdTomato / + y Celf4-iCreER / + Knockin cepas de ratón

los El ratón Scrt2-tdTomato / + se generó co-inyectando un ARNg pre-probado contra Scrt2, ADN del donante (Figura 4 - Figura 1), y ARNm de Cas9 en cigotos de ratón de etapa única. los Scrt2 La secuencia de sgRNA utilizada fue 5ʹ- Gcctcggcgggcatcccgca -3ʹ. Las secuencias detalladas de ADN del donante están disponibles a pedido. Se utilizó la PCR de unión para cribar ratones F0, después de lo cual los ratones F0 se cruzaron con ratones C57BL / 6 de tipo salvaje para la transición de la línea germinal y para producir ratones F1. Los ratones F1 se cribaron adicionalmente usando PCR de unión y transferencia Southern (Figura 4, suplemento de figura 1D y E). Los resultados de la transferencia Southern confirmaron que no se produjo una inserción aleatoria de ADN del donante en los genomas del ratón. La transferencia Southern se realizó de acuerdo con nuestro protocolo descrito anteriormente (Li et al., 2018). La PCR de ADN de cola nos permitió distinguir el tipo salvaje (+/+), heterocigoto (KI / +) y homocigotos (KI / KI) ratones. Cuando se usaron los cebadores F2 y R1, el amplicón de PCR de KI obtenido tenía una longitud de 894 pb a la inversa, con los cebadores F1 y R1, el amplicón de PCR de tipo salvaje obtenido tenía una longitud de 350 pb. Teóricamente, los cebadores F1 y R1 deberían generar una banda de 1844 pb en el alelo KI, pero debido al corto tiempo de extensión de nuestro protocolo de PCR, esta banda no se produjo.

Para producir el Celf4-iCreER / + cepa, un pre-probado Celf4 Se inyectaron ARNm, ADN de donante y ARNm de Cas9 en cigotos de ratón de una sola etapa celular. Todos los demás procedimientos fueron idénticos a los descritos anteriormente y, por lo tanto, no se repiten aquí. Seleccionamos el gen Celf4-201 (ENSMUST00000025117.13 en el sitio web de Ensembl) para la selección de genes. La secuencia de ARNg de Celf4 utilizada fue 5ʹ-tacgggcgattggcgtcttt -3ʹ. El análisis de transferencia Southern descartó la inserción aleatoria de ADN del donante en los genomas de ratón. Cuando se usaron los cebadores F1 y R1, el amplicón de PCR de tipo salvaje obtenido tenía una longitud de 471 pb con los cebadores F2 y R1, el amplicón de PCR de KI tenía una longitud de 612 pb. Como antes, los cebadores F1 y R1 no produjeron con éxito un amplicón de 3402 pb en el alelo KI debido al tiempo de extensión limitado de nuestro protocolo de PCR. Todas las secuencias utilizadas para los cebadores de genotipado-PCR para las dos cepas de ratón se enumeran en el archivo complementario 2. Estas dos cepas estarán disponibles en The Jackson Laboratory Repository (http://jaxmice.jax.org/query) bajo JAX Stock Nos. 034390 y 034391.

Procesamiento de muestras, histología e inmunofluorescencia e hibridación in situ de ARN

Para el análisis de rastreo de linaje de Celf4-iCreER / + Rosa26-CAG-loxp-stop-loxp-tdTomato / + ratones, se administró tamoxifeno (T5648, Sigma) disuelto en aceite de maíz (C8267, Sigma) a P1 / 2 o P8 / 9 en una dosis de 3 mg / 40 g de peso corporal, o en P30 / 31 a una dosis de 9 mg / 40 g de peso corporal. Se disecaron tejidos del oído interno de ratones embrionarios o de ratones menores de P10 y se fijaron en PFA fresco al 4% durante la noche a 4ºC. Los ratones mayores que P10 se perfundieron en el corazón con 1 x PBS y luego se perfundieron con PFA al 4% fresco, y esto fue seguido por una segunda fijación en PFA al 4% fresco durante la noche a 4 ° C. Los tejidos del oído interno se lavaron tres veces con 1 × PBS y luego se usaron directamente en el análisis de montaje completo o se remojaron en sacarosa al 30% a 4 ° C durante la noche, se incluyeron en OCT, se crioseccionaron a 14 μm de espesor y luego se examinaron.

Se utilizaron los siguientes anticuerpos primarios: anti-Myosin-VI (conejo, 1: 200, Cat #: 25-6791, RRID: AB_10013626, Proteus Bioscience), anti-Mafb (conejo, 1: 300, Cat #: HPA005653, RRID : AB_1079293, Sigma), anti-GFP (pollo, 1: 1000, Cat #: ab13970, RRID: AB_300798, Abcam), anti-Sox2 (cabra, 1: 1000, Cat #: sc-17320, RRID: AB_2286684, Santa Cruz Biotechnology), anti-HA (rata, 1: 200, Cat #: 11867423001, RRID: AB_390918, Sigma), anti-Tuj1 (mouse, 1: 500, Cat #: 801201, RRID: AB_2313773, BioLegend), anti- Gata3 (cabra, 1: 200, Cat #: AF2605, RRID: AB_2108571, sistemas R y D), anti-Map2 (conejo, 1: 400, Cat #: M3696, RRID: AB_1840999, Sigma) y anti-Sox10 ( cabra, 1: 200, Cat #: sc-17342, RRID: AB_2195374, Santa Cruz Biotechnology). Todos los anticuerpos secundarios se adquirieron en Thermo Scientific (Molecular Probes) o Jackson ImmunoResearch Laboratory. Durante el último paso de la inmunotinción, las muestras se tiñeron por contraste con la solución Hoechst33342 (1: 1000, Cat #: 62249, RRID: AB_2651135, Thermo Scientific) en 1x PBS para visualizar los núcleos. Los portaobjetos se montaron con medio de montaje anti-decoloración Prolong Gold (Cat #: P36930, RRID: SCR_015961, Thermo Scientific). Todas las imágenes se capturaron con un microscopio confocal Nikon NiE-A1 plus o Nikon C2 y se analizaron con Image-J. Para obtener protocolos detallados de histología del oído interno, consulte nuestro estudio anterior (Liu et al., 2010). La hibridación de ARN in situ se realizó de acuerdo con los protocolos descritos anteriormente (Li et al., 2018). La secuencia detallada de la sonda de ARN para cada gen se enumeró en el archivo complementario 3.

Cuantificación y análisis estadístico de tdTomato + SGNs en Celf4-iCreER / + Rosa26-CAG-loxp-stop-loxp-tdTomato / + ratones

Cuantificar el número de tdTomato + SGN en los distintos giros cocleares de Celf4-iCreER / + Rosa26-CAG-loxp-stop-loxp-tdTomato / + En ratones de diferentes edades, utilizamos un enfoque de criosección (Figura 6 y Figura 6 — suplemento de figura 2D-E ’’). Para discriminar con precisión los SGN en los giros basal, medio y apical, analizamos solo aquellos cortes de criosección del oído interno que incluían los tres giros cocleares (Figura 6B, E y H, y Figura 6 - figura suplementaria 2D-E ’’). Para cada corte obtenido del mismo ratón, determinamos, por turno coclear, el número de SGN duales tdTomato + / Tuj1 + (o Map2 + o Mafb +), y luego normalizamos estos números contra el número total de SGN Tuj1 + (o Map2 + o Mafb +) a obtener un porcentaje promedio de tdTomato + SGNs. Estos resultados se presentan como medias ± SEM (Figura 6K – M, y Figura 6 — figura suplementaria 2F, n = 3 números de ratón / edad). Los análisis estadísticos se realizaron utilizando un ANOVA de una vía, seguido de un t prueba con corrección de Bonferroni. GraphPad Prism 6.0 se utilizó para todos los análisis estadísticos.


¿Cómo puedo determinar la pureza de las células aisladas de cerebros de ratas si no puedo usar FACS, inmunohistoquímica o análisis SEM? - biología

La obtención de imágenes en tiempo real de las células madre trasplantadas es esencial para comprender sus interacciones. en vivo con entornos de host, para rastrear el destino y la función de las células y para una entrega exitosa y monitoreo de seguridad en el entorno clínico. En este estudio, usamos bioluminiscencia (BLI) y resonancia magnética (MRI) para visualizar el destino de células madre neurales humanas (hNSC) derivadas de células madre embrionarias humanas injertadas (hESC) en cerebro de rata dañado por accidente cerebrovascular. Las hNSC se diseñaron genéticamente con un vector lentiviral que lleva un gen indicador de doble fusión (DF) que expresó de manera estable genes indicadores de proteína de fluorescencia verde mejorada (eGFP) y luciferasa de luciérnaga (fLuc). Las hNSC eran auto-renovables, multipotentes y expresaban marcadores de células madre neurales. La supervivencia celular se siguió de forma no invasiva mediante resonancia magnética y BLI durante 2 meses después del trasplante y se confirmó histológicamente. El registro electrofisiológico de células GFP + injertadas y la microscopía inmunoelectrónica demostraron conectividad. Las hNSC injertadas se diferenciaron en neuronas, en oligodendrocitos en las regiones de accidente cerebrovascular sometidas a remielinización y en astrocitos extendiendo procesos hacia vasculaturas dañadas por accidente cerebrovascular. Nuestros datos sugieren que la combinación de las modalidades BLI y MRI proporciona un monitoreo confiable en tiempo real del destino celular.


Discusión

Nuestro análisis reveló que las neuronas en el neocórtex cerebral humano adulto tienen niveles de 14 C en su ADN genómico correspondientes a los niveles atmosféricos en el momento en que nació el individuo, y no pudimos detectar neuronas marcadas con BrdU, lo que argumenta en contra de la neurogénesis cortical posnatal en humanos. .

Es importante subrayar que nuestros dos enfoques para detectar el recambio celular en el neocórtex adulto tienen límites de detección y que no podemos excluir la neurogénesis por debajo de este nivel. La datación retrospectiva de los nacimientos con 14 C proporciona una medida acumulativa que proporciona una alta sensibilidad para detectar una generación continua de bajo grado de nuevas células, incluso si estas células representarían solo el 1% de las neuronas durante toda la vida útil en el área analizada (23) . Sin embargo, esto requiere que las células recién nacidas se integren de manera estable y se mantengan. Se ha sugerido que las neuronas recién nacidas en el neocórtex del mono tienen una vida útil corta y no se mantienen a largo plazo (5). Si en un momento dado tales neuronas representan & lt1% de las neuronas en el área analizada, no serían detectables mediante la datación de nacimiento con 14 C retrospectiva con la sensibilidad actual.

En este contexto, el marcaje con BrdU tiene la ventaja de que marca las células recién nacidas en un momento dado, y sería fácil detectar mucho menos del 1% de las neuronas marcadas en el momento del análisis. El período de tiempo entre la administración de BrdU y la muerte de los individuos que analizamos osciló entre 4,2 meses y 4,3 años. Por tanto, nuestros resultados indican que sólo puede haber poca (& lt1%), si es que hay alguna, integración estable de neuronas corticales en el cerebro humano adulto, y si hay una producción de neuronas transitorias, tienen una vida útil de & lt4,2 meses.

Además, podemos integrar la información obtenida mediante la fecha de nacimiento retrospectiva y el etiquetado BrdU para estimar el nivel máximo de neurogénesis neocortical adulta que podría pasar desapercibido mediante la combinación de ambos métodos. Con la edad promedio establecida de todas las células, el mayor número teórico de células generadas en la edad adulta sería si hay dos poblaciones, una generada alrededor del nacimiento y el resto generada contemporáneamente. Si configuramos la población generada antes del nacimiento para que nazca en el momento del nacimiento (la edad promedio de las neuronas corticales), podemos calcular, en base a la edad promedio de todas las células, que una población nacida durante los últimos 5 años (en promedio 2,5 años antes del análisis) constituirían el 37% de todas las células de nuestra población (calculado para cada individuo, dada la edad media conocida de todas las células de esa persona, el 37% representa el promedio de todos los individuos). Dados nuestros datos de BrdU, sabemos que como máximo 1 de 516 células nacidas en adultos podrían ser neuronas (en nuestro estudio, 0 de 515 células marcadas con BrdU se consideraron neuronas, sin embargo, no podemos descartar que si el tamaño de la muestra hubiera sido mayor , es posible que hayamos detectado células BrdU + / NeuN + y, por lo tanto, establecemos que el número de neuronas como máximo es 1 de 516). Dado que como máximo el 37% de la población se revirtió en los últimos 5 años, estimamos que & lt0.07% (0.37 de 1 de 516) de las células en el neocórtex humano adulto podría representar una neurona que se generó durante los últimos 5 años. años y que se integró de manera estable.

Varios estudios han demostrado la presencia de células con in vitro potencial de células madre neurales en la corteza humana, incluida la sustancia blanca subcortical (31). Nuestros resultados no excluyen la posibilidad de que la neurogénesis neocortical pueda ocurrir en ciertas patologías, o que sea posible inducirla, como se ha sugerido en la corteza de roedores (9, 10, 32). No hay neurogénesis mínima o nula en el cuerpo estriado del roedor en condiciones normales, pero se generan un gran número de neuronas en respuesta a la administración de factor de crecimiento o accidente cerebrovascular (15, 16, 33, 34). Aunque nuestro estudio actual indica que la neurogénesis neocortical no ocurre en humanos en condiciones normales, será importante analizar si existe un potencial latente que resulte en neurogénesis en situaciones patológicas.

Existen claras diferencias de especies con respecto al grado de neurogénesis adulta en vertebrados. Es posible que se agreguen grandes cantidades de neuronas a lo largo de la vida de los peces (35). Sin embargo, los peces a menudo continúan creciendo, lo que podría verse como una continuación del desarrollo. Se agregan cantidades sustanciales de nuevas neuronas, incluidas tanto interneuronas como neuronas de proyección, a varias regiones de aves como los pinzones cebra y los canarios (36). En roedores, las interneuronas se agregan a la circunvolución dentada del hipocampo y al bulbo olfatorio en animales maduros (14). Hay muchos informes que indican más neurogénesis de bajo grado en otras áreas del cerebro de los roedores, pero muchos de estos estudios esperan confirmación. El número de neuronas que se agregan en el hipocampo y el bulbo olfatorio de los roedores disminuye sustancialmente con la edad, aunque la neurogénesis continúa en niveles bajos durante toda la vida. Los estudios de 3 H-timidina indicaron originalmente que hay menos neurogénesis adulta en el cerebro de los primates (37, 38), y estudios posteriores que utilizaron BrdU han demostrado niveles relativamente más bajos de neurogénesis en la circunvolución dentada y el bulbo olfatorio en comparación con los roedores (39-41). . Un estudio demostró la neurogénesis en la circunvolución dentada del ser humano adulto (30), pero sigue siendo controvertido si se añaden neuronas al bulbo olfatorio humano adulto (42, 43). Por tanto, la distribución de la neurogénesis adulta parece haber sido gradualmente más restringida con la evolución, aunque todavía hay información limitada disponible sobre la extensión y distribución de la neurogénesis en el cerebro humano adulto.

La plasticidad es un aspecto importante de la función cortical y es necesaria, por ejemplo, para la integración de nuevos recuerdos. También es fácil ver la importancia de la estabilidad para el mantenimiento de la memoria, por ejemplo. Debe haber un delicado equilibrio entre plasticidad y estabilidad, y la falta de neurogénesis neocortical humana sugiere que se ha favorecido la estabilidad celular.


El tráfico de células inmunes desde el cerebro mantiene la tolerancia inmunitaria del SNC

1 Laboratorio de Neuroinflamación, Centro de Investigación Médica Aplicada de San Vicente y Universidad de Nueva Gales del Sur, Sydney, Nueva Gales del Sur, Australia. 2 Facultad de Ciencias Biomédicas y Queensland Brain Institute, Universidad de Queensland, Brisbane, Queensland, Australia. 3 Instituto Teletón de Investigación en Salud Infantil, Universidad de Australia Occidental, Perth, Australia Occidental, Australia. 4 Laboratorio de Estructura y Función Neuronal, Instituto Salk de Estudios Biológicos, La Jolla, California, EE. UU.

Envíe la correspondencia a: David A. Brown, Laboratorio de Neuroinflamación, Centro de Investigación Médica Aplicada de San Vicente, 405 Liverpool St., Sydney 2010, Nueva Gales del Sur, Australia. Teléfono: 61.02.8382.4952 Fax: 61.02.8382.4971 Correo electrónico: [email protected]

Nota de autoría: Mohammad G. Mohammad y Vicky W.W. Tsai contribuyó igualmente a este trabajo.

Encuentre artículos de Mohammad, M. en: JCI | PubMed | Google Académico

1 Laboratorio de Neuroinflamación, Centro de Investigación Médica Aplicada de San Vicente y Universidad de Nueva Gales del Sur, Sydney, Nueva Gales del Sur, Australia. 2 Facultad de Ciencias Biomédicas y Queensland Brain Institute, Universidad de Queensland, Brisbane, Queensland, Australia. 3 Instituto Teletón de Investigación en Salud Infantil, Universidad de Australia Occidental, Perth, Australia Occidental, Australia. 4 Laboratorio de Estructura y Función Neuronal, Instituto Salk de Estudios Biológicos, La Jolla, California, EE. UU.

Dirigir la correspondencia a: David A. Brown, Laboratorio de Neuroinflamación, St.Vincent's Center for Applied Medical Research, 405 Liverpool St., Sydney 2010, Nueva Gales del Sur, Australia. Teléfono: 61.02.8382.4952 Fax: 61.02.8382.4971 Correo electrónico: [email protected]

Nota de autoría: Mohammad G. Mohammad y Vicky W.W. Tsai contribuyó igualmente a este trabajo.

1 Laboratorio de Neuroinflamación, Centro de Investigación Médica Aplicada de San Vicente y Universidad de Nueva Gales del Sur, Sydney, Nueva Gales del Sur, Australia. 2 Facultad de Ciencias Biomédicas y Queensland Brain Institute, Universidad de Queensland, Brisbane, Queensland, Australia. 3 Instituto Teletón de Investigación en Salud Infantil, Universidad de Australia Occidental, Perth, Australia Occidental, Australia. 4 Laboratorio de Estructura y Función Neuronal, Instituto Salk de Estudios Biológicos, La Jolla, California, EE. UU.

Envíe la correspondencia a: David A. Brown, Laboratorio de Neuroinflamación, Centro de Investigación Médica Aplicada de San Vicente, 405 Liverpool St., Sydney 2010, Nueva Gales del Sur, Australia. Teléfono: 61.02.8382.4952 Fax: 61.02.8382.4971 Correo electrónico: [email protected]

Nota de autoría: Mohammad G. Mohammad y Vicky W.W. Tsai contribuyó igualmente a este trabajo.

Encuentre artículos de Ruitenberg, M. en: JCI | PubMed | Google Académico

1 Laboratorio de Neuroinflamación, Centro de Investigación Médica Aplicada de San Vicente y Universidad de Nueva Gales del Sur, Sydney, Nueva Gales del Sur, Australia. 2 Facultad de Ciencias Biomédicas y Queensland Brain Institute, Universidad de Queensland, Brisbane, Queensland, Australia. 3 Instituto Teletón de Investigación en Salud Infantil, Universidad de Australia Occidental, Perth, Australia Occidental, Australia. 4 Laboratorio de Estructura y Función Neuronal, Instituto Salk de Estudios Biológicos, La Jolla, California, EE. UU.

Envíe la correspondencia a: David A. Brown, Laboratorio de Neuroinflamación, Centro de Investigación Médica Aplicada de San Vicente, 405 Liverpool St., Sydney 2010, Nueva Gales del Sur, Australia. Teléfono: 61.02.8382.4952 Fax: 61.02.8382.4971 Correo electrónico: [email protected]

Nota de autoría: Mohammad G. Mohammad y Vicky W.W. Tsai contribuyó igualmente a este trabajo.

Encuentre artículos de Hassanpour, M. en: JCI | PubMed | Google Académico

1 Laboratorio de Neuroinflamación, Centro de Investigación Médica Aplicada de San Vicente y Universidad de Nueva Gales del Sur, Sydney, Nueva Gales del Sur, Australia. 2 Facultad de Ciencias Biomédicas y Queensland Brain Institute, Universidad de Queensland, Brisbane, Queensland, Australia. 3 Instituto Teletón de Investigación en Salud Infantil, Universidad de Australia Occidental, Perth, Australia Occidental, Australia. 4 Laboratorio de Estructura y Función Neuronal, Instituto Salk de Estudios Biológicos, La Jolla, California, EE. UU.

Envíe la correspondencia a: David A. Brown, Laboratorio de Neuroinflamación, Centro de Investigación Médica Aplicada de San Vicente, 405 Liverpool St., Sydney 2010, Nueva Gales del Sur, Australia. Teléfono: 61.02.8382.4952 Fax: 61.02.8382.4971 Correo electrónico: [email protected]

Nota de autoría: Mohammad G. Mohammad y Vicky W.W. Tsai contribuyó igualmente a este trabajo.

1 Laboratorio de Neuroinflamación, Centro de Investigación Médica Aplicada de San Vicente y Universidad de Nueva Gales del Sur, Sydney, Nueva Gales del Sur, Australia. 2 Facultad de Ciencias Biomédicas y Queensland Brain Institute, Universidad de Queensland, Brisbane, Queensland, Australia. 3 Instituto Teletón de Investigación en Salud Infantil, Universidad de Australia Occidental, Perth, Australia Occidental, Australia. 4 Laboratorio de Estructura y Función Neuronal, Instituto Salk de Estudios Biológicos, La Jolla, California, EE. UU.

Envíe la correspondencia a: David A. Brown, Laboratorio de Neuroinflamación, Centro de Investigación Médica Aplicada de San Vicente, 405 Liverpool St., Sydney 2010, Nueva Gales del Sur, Australia. Teléfono: 61.02.8382.4952 Fax: 61.02.8382.4971 Correo electrónico: [email protected]

Nota de autoría: Mohammad G. Mohammad y Vicky W.W. Tsai contribuyó igualmente a este trabajo.

1 Laboratorio de Neuroinflamación, Centro de Investigación Médica Aplicada de San Vicente y Universidad de Nueva Gales del Sur, Sydney, Nueva Gales del Sur, Australia. 2 Facultad de Ciencias Biomédicas y Queensland Brain Institute, Universidad de Queensland, Brisbane, Queensland, Australia. 3 Instituto Teletón de Investigación en Salud Infantil, Universidad de Australia Occidental, Perth, Australia Occidental, Australia. 4 Laboratorio de Estructura y Función Neuronal, Instituto Salk de Estudios Biológicos, La Jolla, California, EE. UU.

Envíe la correspondencia a: David A. Brown, Laboratorio de Neuroinflamación, Centro de Investigación Médica Aplicada de San Vicente, 405 Liverpool St., Sydney 2010, Nueva Gales del Sur, Australia. Teléfono: 61.02.8382.4952 Fax: 61.02.8382.4971 Correo electrónico: [email protected]

Nota de autoría: Mohammad G. Mohammad y Vicky W.W. Tsai contribuyó igualmente a este trabajo.

1 Laboratorio de Neuroinflamación, Centro de Investigación Médica Aplicada de San Vicente y Universidad de Nueva Gales del Sur, Sydney, Nueva Gales del Sur, Australia. 2 Facultad de Ciencias Biomédicas y Queensland Brain Institute, Universidad de Queensland, Brisbane, Queensland, Australia. 3 Instituto Teletón de Investigación en Salud Infantil, Universidad de Australia Occidental, Perth, Australia Occidental, Australia. 4 Laboratorio de Estructura y Función Neuronal, Instituto Salk de Estudios Biológicos, La Jolla, California, EE. UU.

Envíe la correspondencia a: David A. Brown, Laboratorio de Neuroinflamación, Centro de Investigación Médica Aplicada de San Vicente, 405 Liverpool St., Sydney 2010, Nueva Gales del Sur, Australia. Teléfono: 61.02.8382.4952 Fax: 61.02.8382.4971 Correo electrónico: [email protected]

Nota de autoría: Mohammad G. Mohammad y Vicky W.W. Tsai contribuyó igualmente a este trabajo.

Encuentre artículos de Sawchenko, P. en: JCI | PubMed | Google Académico

1 Laboratorio de Neuroinflamación, Centro de Investigación Médica Aplicada de San Vicente y Universidad de Nueva Gales del Sur, Sydney, Nueva Gales del Sur, Australia. 2 Facultad de Ciencias Biomédicas y Queensland Brain Institute, Universidad de Queensland, Brisbane, Queensland, Australia. 3 Instituto Teletón de Investigación en Salud Infantil, Universidad de Australia Occidental, Perth, Australia Occidental, Australia. 4 Laboratorio de Estructura y Función Neuronal, Instituto Salk de Estudios Biológicos, La Jolla, California, EE. UU.

Envíe la correspondencia a: David A. Brown, Laboratorio de Neuroinflamación, Centro de Investigación Médica Aplicada de San Vicente, 405 Liverpool St., Sydney 2010, Nueva Gales del Sur, Australia. Teléfono: 61.02.8382.4952 Fax: 61.02.8382.4971 Correo electrónico: [email protected]

Nota de autoría: Mohammad G. Mohammad y Vicky W.W. Tsai contribuyó igualmente a este trabajo.

Publicado el 24 de febrero de 2014 - Más información

Artículo relacionado:

Neurogénesis o no neurogénesis: esa es la cuestión

Neurogénesis o no neurogénesis: esa es la cuestión

Abstracto

Las células madre neurales / precursoras (NPC) que residen dentro de los nichos germinales del SNC adulto tienen funciones más complejas de lo que se esperaba anteriormente. Además de sus funciones neurogénicas bien documentadas, la evidencia emergente indica que los NPC ejercen funciones no neurogénicas que contribuyen a la regulación y preservación de la homeostasis tisular tanto en condiciones fisiológicas como patológicas. En este número de la JCI, Mohammad et al. encontraron que las CD patrullan eficientemente el SNC solo cuando el nicho germinal de la zona subventricular funciona correctamente. De hecho, las CD viajaron desde los ventrículos a lo largo de la corriente migratoria rostral hasta el bulbo olfatorio (un punto de acceso a los ganglios linfáticos cervicales) para amortiguar las respuestas inmunitarias anti-SNC. Los hallazgos de los autores & # x2019 respaldan aún más un papel no neurogénico de los NPC en el mantenimiento de la homeostasis tisular y la promoción de la protección tisular en el cerebro adulto.

Autores

Gianvito Martino, Erica Butti, Marco Bacigaluppi

En el SNC, no se ha caracterizado ninguna vía dedicada a la vigilancia inmunitaria para prevenir las respuestas inmunitarias anti-SNC que se desarrollan en la enfermedad neuroinflamatoria autoinmune. Aquí, identificamos una vía para que las células inmunes se trasladen desde el cerebro que está asociada con la corriente migratoria rostral (RMS), que es una fuente de neuronas recién generadas en el prosencéfalo. La evaluación de la migración de leucocitos marcados con fluorescencia en ratones reveló que las CD viajan a través del RMS desde el SNC hasta las LN cervicales (CxLN), donde presentan antígeno a las células T. La interrupción farmacológica del tráfico de células inmunitarias con el fármaco secuestrador de células mononucleares fingolimod influyó en las respuestas de células T anti-SNC en las CxLN y moduló la gravedad de la encefalomielitis autoinmune experimental (EAE) en un modelo de ratón de esclerosis múltiple (EM). El tratamiento con fingolimod también indujo EAE en una cepa de ratón transgénico resistente a la enfermedad alterando las funciones de Treg mediadas por DC en CxLN y alterando la tolerancia inmune del SNC. Estos datos describen una vía de células inmunes que se origina en el SNC y es capaz de amortiguar las respuestas inmunes anti-SNC en la periferia. Además, estos datos proporcionan información sobre cómo el tratamiento con fingolimod podría exacerbar la neuroinflamación del SNC en algunos casos y sugieren que las intervenciones terapéuticas focales, fuera del SNC, tienen el potencial de modificar selectivamente la inmunidad anti-SNC.

Desde el trabajo de Sheri y el de Murphy y Sturm (1), el paradigma predominante ha sido que el estado inmunológico inerte del parénquima del SNC se mantiene mediante la exclusión de componentes clave del sistema inmunológico. Sin embargo, ahora se sabe que los linfocitos T sistémicos, reclutados por el plexo coroideo (2), normalmente transitan por el SNC y participan en la vigilancia inmunitaria (3). Las células Th promotoras de enfermedades también penetran directamente la barrera hematoencefálica intacta (4), y las APC circulantes también pueden acceder al parénquima del SNC en condiciones normales (5), mediando la entrada de células T patógenas (6). El hecho de que el sistema inmunológico periférico tenga acceso al SNC (7 - 9) en salud y enfermedad plantea la cuestión de si los mecanismos activos regulan el privilegio inmunológico del SNC. Sin embargo, fuera de las vías neuroendocrinas establecidas (10), no se ha definido un mecanismo por el cual el cerebro puede regular negativamente las respuestas inmunitarias sistémicas dirigidas contra sí mismo. En otros órganos, las APC actúan junto con los LN drenantes para promover o retrasar la activación de las células T, regulando así las respuestas inmunitarias adaptativas específicas de los órganos (11). Un ejemplo destacado de este concepto se ve en el hígado, que puede regular la inmunidad contra sí mismo en la medida en que los trasplantes con MHC no emparejados pueden aceptarse sin una terapia inmunosupresora sustancial (12). Esto ocurre en parte debido al aumento de la función de Treg, que puede estar mediada por las CD que se encuentran en los LN que drenan (11, 12).

Si bien los mecanismos que subyacen a la vigilancia inmunitaria en el SNC normal no se comprenden bien, el papel del sistema inmunológico en la enfermedad inflamatoria del SNC MS y su modelo animal, EAE, se han estudiado extensamente. Estos estudios indican que los LN cervicales (CxLN) son un sitio importante para la activación sistémica de las células T específicas del SNC (13). Los CxLN reciben información del SNC en forma de antígenos y quizás CD (14) y son un sitio para la activación de respuestas inmunes destructivas anti-SNC (7 - 9, 14). Sin embargo, también hay datos que sugieren la existencia de mecanismos inmunorreguladores que mantienen y / o restablecen la integridad del SNC en esta ubicación (15). Los estudios en animales indican que las células T autorreactivas del SNC participan en el mantenimiento de la salud del SNC (16, 17). Los datos clínicos sugieren que estas células T autorreactivas del SNC incluso participan en la recuperación de enfermedades neuroinflamatorias autoinmunes, como la EM (15). Curiosamente, un fármaco terapéutico para la EM con licencia reciente, fingolimod (también conocido como FTY o FTY720), interrumpe el tráfico de células T reactivas al SNC. Este fármaco, un inhibidor del receptor de esfingosina-1-fosfato (S1PR), evita la salida de linfocitos de los LN (18). El fingolimod también previene la migración de DC de los órganos periféricos a los LN (19, 20) y aumenta la función de Treg (21). Si bien se cree que su acción dominante se debe al secuestro de células T autorreactivas en los LN, es posible que sus otras acciones sobre el tráfico de células inmunes que no son células T también tengan consecuencias.

Aquí, utilizando el tratamiento con fingolimod y una variedad de otros métodos, identificamos y caracterizamos el tráfico de DC desde el SNC al compartimento inmunológico sistémico. Esta vía moduló directamente la función de Treg en los CxLN y redujo la enfermedad autoinflamatoria del SNC, lo que sugiere que, en última instancia, evita que las células T patógenas entren en el SNC. La interrupción de esta vía con la infusión localizada de fingolimod condujo a una reducción de la tolerancia inmunitaria del SNC, una mejora de las respuestas autoinmunitarias anti-SNC y una enfermedad inflamatoria del SNC.

Las células CD11c + están asociadas con la corriente migratoria rostral (RMS). Las APC están presentes en el plexo coroideo y las meninges (22), sin embargo, su localización en el parénquima cerebral en la salud es discutida (23, 24). Nuestro examen del cerebro de ratón normal con inmunomarcaje doble demostró una asociación de células CD11c + con el RMS, una vía a lo largo de la cual los neuroblastos viajan desde el ventrículo lateral al bulbo olfatorio (OB) para reemplazar las interneuronas olfativas (Figura 1A). Se encontraron células CD11c + en todo el RMS (Figura 1B), incluido su campo terminal, la capa de células granulares del OB. Además, estas células se encontraron en la capa glomerular, adyacente a la placa cribiforme. La distribución de células CD11c + a lo largo del RMS y la extensión al OB sugirió que esta podría ser un área importante para la inmunorregulación del SNC. Por lo tanto, examinamos el RMS y las estructuras circundantes de materia blanca y gris para detectar la presencia de células CD11c +. En los cerebros de ratones normales, libres de patógenos específicos, las células CD11c + se asociaron preferentemente con el RMS a densidades significativamente más altas en comparación con las estructuras de materia gris o blanca circundantes (Figura 1C). Para caracterizar aún más estas DC putativas, aislamos células CD11c + de 10 ratones normales y las examinamos mediante clasificación de células activadas por fluorescencia (FACS). Eran predominantemente CD CD11c + CD11b +, junto con CD plasmacitoides (pDC) típicas y una población de otros fenotipos de CD (Figura 1D y material complementario de la Figura 2 complementaria disponible en línea con este artículo doi: 10.1172 / JCI71544DS1). Para abordar la posibilidad de que las células especializadas similares a los macrófagos cerebrales conocidas como microglía pudieran expresar CD11c, realizamos un examen confocal adicional de secciones cerebrales para definir la ubicación anatómica de las células CD11c + y confirmar que en realidad eran CD. Esto mostró la presencia de células CD11c + CD11b - en el plexo coroideo y en asociación con el RMS (Figura 1, E y F) la falta de CD11b en estas células sugirió que eran verdaderas CD. Estas células y un subgrupo de células CD11c + CD11b + tenían un aspecto similar, claramente diferente al de la microglía CD11b + CD11c residente (Figura 1F). Finalmente, encontramos que una porción sustancial de estas DC RMS estaban realmente ubicadas en el parénquima (Figura 2).

Las células inmunes están asociadas con el RMS. (A) Se marcaron secciones sagitales para CD11c mediante IHC, seguido de tinción IF para DCX (verde), que muestra el curso del RMS desde la zona subventricular hasta el OB. AOV, núcleo olfatorio anterior ventral ACB, núcleo accumbens CP, putamen caudado. El cuadro indica la región que se muestra con mayor aumento en B. (B) El RMS, que muestra células CD11c (puntas de flecha rojas) en estrecha asociación con neuroblastos DCX + migratorios. (C) Se contaron las células CD11c + en el RMS en al menos 5 secciones. El cuerpo calloso (CC) y la corteza frontal (FCx) en las mismas secciones se examinaron de manera similar. Los datos representan la media ± SEM. *PAG & lt 0,001 frente a RMS. (D) Análisis fenotípico de células CD11c + aisladas de 10 prosencéfalos de ratón (para la estrategia de activación, consulte la Figura complementaria 2). Las células CD11c + CD11b + representaron el 70% de las CD, las pDC representaron el 10% y el resto perteneció a otros subconjuntos CD11c + CD11b - CD (3 experimentos independientes). (mi) IF imágenes confocales para DCX (verde), CD11b (azul) y CD11c (rojo). Las células CD11c + (punta de flecha roja) y CD11b + (punta de flecha azul) se identifican en el plexo coroideo adyacente a la zona subventricular DCX + en ratones normales. (F) CD11c + CD11b + CD (flecha azul), CD11c + CD11b - CD (flecha roja) y CD11b + microglía (flechas blancas) en estrecha asociación con el RMS (DCX verde). Barras de escala: 250 μm (A) 25 μm (B) 10 μm (mi y F).

La mayoría de las células RMS CD11c + no están asociadas con la vasculatura cerebral. Para mostrar que las células CD11c + en el RMS eran intraparenquimatosos, realizamos un corte óptico en serie (pasos de 1 μm) a través del RMS utilizando microscopía confocal (norte = 5). Las secciones se tiñeron con DCX (RMS verde), CD11c (DC rojo) y CD31 (endotelio vascular azul). Se muestra una serie representativa que demuestra una célula CD11c + perivascular típica (flecha azul) y 2 ejemplos de las diversas células CD11c + en el RMS que no estaban asociadas con ninguna vasculatura (flechas rojas). Barra de escala: 100 μm.

Las células CD11c + en el RMS son CD derivadas de la circulación. Para establecer el origen de las CD presentes en el RMS, se generaron ratones quiméricos trasplantando BM de ratones singénicos C57BL / 6 que expresaban GFP bajo el control del Cx3cr1 promotor, que es activo en células de linaje de monocitos (25). 12 semanas después del trasplante de BM, las células GFP + CD11b - estaban presentes a lo largo del curso del RMS y su campo terminal. La distribución parenquimatosa de estas células fue similar a la de los ratones normales no manipulados, mientras que la coexpresión de GFP proporcionó evidencia de su origen periférico (en lugar de CNS). Usando microscopía confocal de múltiples etiquetas, identificamos subconjuntos de células GFP + CD11b + y GFP + CD11b -. Estas células estaban nuevamente presentes en el plexo coroideo adyacente al origen del RMS y en todo el RMS y su campo terminal (Figura 3, A y B), lo que sugiere la presencia tanto de convencional (CD11c + CD11b +) como no convencional ( CD11c + CD11b -) DC en esta región. Para los macrófagos, el reclutamiento del plexo coroideo está mediado por VLA4 para la unión y CD73 para la migración a través del epitelio coroideo (26). De hecho, el tratamiento sistémico de ratones con el inhibidor de CD73 metileno ADP condujo a cambios significativos en el número de macrófagos, pero no en el número de DC (Figura complementaria 1), lo que sugiere que la migración de DC al SNC no está modulada por CD73. No obstante, la presencia de células CD11c + CD11b - con orígenes circulatorios periféricos representa una fuerte evidencia de que las verdaderas CD están presentes en el SNC adulto.

Los países en desarrollo derivados de la sangre se reclutan para el RMS. Cx3cr1 + / gfp Se sacrificaron ratones quiméricos de -a-WT BM 12 semanas después de BMT. Las secciones de cerebro se marcaron para DCX (azul), CD11b (azul o rojo) y / o CD11c (rojo). La fluorescencia de GFP se muestra en verde. (A) Imágenes confocales que muestran la presencia de células GFP + CD11c + (flecha roja) y células GFP + CD11b + (flecha azul, es decir, derivadas de la MO del donante) en el plexo coroideo. (B) GFP + CD11b: las células derivadas de la circulación, presumiblemente no macrófagos / microglia y, por lo tanto, las CD, se observaron nuevamente en estrecha asociación con el RMS (flecha roja), junto con las células GFP - CD11b + (flechas blancas) y GFP + CD11b +. Barras de escala: 10 μm.

Los DC migran del CNS al CxLN. Para determinar si los leucocitos reclutados en el SNC podrían migrar a los CxLN, infundimos CFSE, un fluorocromo vital que marca de manera estable los leucocitos, lo que permite rastrear su migración. Después de 7 días de infusión intracerebroventricular continua (icv) de CFSE en un ventrículo lateral adyacente al plexo coroideo, se detectaron células inmunes marcadas con CFSE en los CxLN (Figura 4A), pero no en otros órganos inmunitarios periféricos secundarios, incluidos los LN inguinales. (Figura 4B) y bazo (datos no mostrados). Estos hallazgos indican que las células marcadas con CFSE se acumularon en los CxLN debido al drenaje de tipo linfático del SNC.

Los leucocitos migran del SNC a los CxLN. En ratones canulados con icv, después de 7 días de infusión de CFSE, se seleccionaron las células CxLN CD45 + y se examinaron para determinar el marcaje de CFSE. (A) Se discernieron células marcadas con CFSE en todos los ratones. Se indica el porcentaje de células CFSE +. (B) Se repitió el mismo experimento con fingolimod o vehículo administrado i.p. (norte = 6 3 experimentos independientes), comenzando 1 día antes de la implantación de la cánula icv. Para la activación de monocitos CFSE + CxLN e ILN, consulte la Figura complementaria 4. Arriba: Los ratones tratados con vehículo (flecha grande) tenían poblaciones sustanciales de supuestos macrófagos CFSE + (CD45 + CD3 - B220 - CD11c - CD11b +), que se redujeron significativamente en CxLN de ratones tratados con fingolimod (flecha pequeña) y ausente en ILN de ratones tratados con vehículo o con fármaco. Abajo: CFSE + DC (CD45 + CD3 - CD11c +) solo se observaron en CxLN de ratones tratados con vehículo (flecha), y su acumulación fue completamente inhibida por el tratamiento sistémico con fingolimod. (C) A los ratones a los que se les infundió CFSE mediante una cánula icv se les extirpó el cerebro y se extrajeron células mononucleares para FACS. Arriba: Acumulación de DC y macrófagos / PMN en el cerebro de ratones canulados. Abajo: Para determinar qué tipo (s) de células pueden haberse acumulado como resultado de una lesión asociada con la canulación de icv, también administramos fingolimod (6 μg / d) o vehículo (norte = 6 3 experimentos independientes) i.p. a ratones no canulados, que demostraron una mayor frecuencia de DC en el SNC según lo evaluado por FACS (PAG = 0,018), sin diferencias en los números correspondientes de macrófagos / PMN o células T. Los datos representan la media ± SEM. *PAG & lt 0,05.

Si las células marcadas con CFSE transitaran desde el cerebro, la interrupción farmacológica de este proceso debería conducir a su retención en el SNC. Por lo tanto, usamos fingolimod, que se sabe que altera el tráfico de linfocitos y CD (19). Repetimos el experimento anterior, pero esta vez también administramos a los ratones por vía i.p. inyecciones de fingolimod o vehículo, comenzando antes de la canulación icv y continuando durante todo el período de infusión de CFSE. En ratones tratados con vehículo, aparecieron leucocitos marcados con CFSE en los CxLN de los ratones sacrificados al final de la infusión de CFSE, y esta acumulación fue inhibida por el tratamiento sistémico con fingolimod (Figura 4B). No hubo acumulación significativa de eventos CD45 + CFSE + en los LN inguinales (ILN) de ratones tratados con fingolimod o con vehículo (Figura 4B). A continuación, caracterizamos la composición de las células que estaban marcadas con CFSE en el SNC y habían migrado a las CxLN. Quizás no sea sorprendente, considerando la lesión inducida por la canulación, la mayoría de las células que migraron a los CxLNs eran CD11b +, con características de dispersión hacia adelante y hacia los lados de los macrófagos. De acuerdo con la mediación de la migración de macrófagos por S1P (27), fingolimod inhibió casi por completo su tránsito a los CxLN (Figura 4B). El siguiente tipo de células marcadas con CFSE más abundante que se encuentra en las CxLN fue CD3 - CD11c + DC, cuya acumulación también fue inhibida por fingolimod (Figura 4B). Prácticamente no se identificaron células T CFSE + CD3 + CD4 + en CxLN de ratones infundidos con CFSE (datos no mostrados). De acuerdo con este hallazgo, el tratamiento sistémico con fingolimod condujo a la acumulación de estos tipos de células en el SNC (Figura 4C). La ausencia de tinción de CFSE generalizada en los CxLN de ratones tratados con fingolimod sistémico y el confinamiento de la tinción de CFSE a subconjuntos de leucocitos específicos también indicó que la fuga inespecífica de tinte a los CxLN no fue un factor de confusión.

El tratamiento sistémico con fingolimod conduce a la acumulación de DC en el SNC normal. Habiendo establecido que el tratamiento con fingolimod prácticamente abolió la salida de leucocitos del cerebro, a continuación determinamos qué leucocitos se retenían preferentemente en cerebros sanos. Estos experimentos se realizaron en ratones que no habían experimentado la lesión que se produjo debido a la canulación del SNC. Los ratones recibieron tratamiento sistémico (i.p.) diario con fingolimod o vehículo. De forma similar a los ratones sometidos a canulación icv, el tratamiento sistémico con fingolimod de ratones no canulados condujo a una acumulación significativamente mayor de CD en el SNC (Figura 4C). Para excluir la posibilidad de que esto estuviera relacionado con una mayor activación de la microglía por alguna razón imprevista, cuantificamos adicionalmente las CD3 - CD11c + CD11b - DC, ya que estas no podrían ser microglías clásicas debido a la ausencia de CD11b. También encontramos un aumento significativo de estas células con el tratamiento con fingolimod (Figura 4C). Estos hallazgos indican que es probable que la entrada y salida de DC del SNC estén reguladas por diferentes mecanismos, ya que su salida (pero no acumulación) fue modulada al menos en parte por fingolimod. En ausencia de canulación, el tratamiento con fingolimod no se asoció con diferencias significativas en la acumulación del subconjunto CD45 hi CD11c - CD11b + macrófagos / células polimorfonucleares (macrófagos / PMN) (Figura 4C).

El tratamiento sistémico con fingolimod altera la distribución de células CD11c + a lo largo del RMS. Nuestros experimentos anteriores indicaron que la mayoría de las células CD11c +, fuera de las estructuras de soporte normales del SNC, estaban asociadas con el RMS (Figura 1). Con base en este hallazgo, razonamos que si la salida de estas células estaba regulada por la terapia sistémica con fingolimod, y si viajaban desde el RMS proximal al distal con neuroblastos migratorios, el tratamiento con fingolimod debería conducir a su acumulación en el RMS distal. Además, no debería haber ningún cambio significativo en el número de células CD11c + en el RMS proximal, ya que la terapia con fingolimod no pareció afectar su reclutamiento. Comparación de ratones tratados con fingolimod y con vehículo (norte = 6 por grupo) reveló una diferencia significativa en la distribución de células CD11c + a lo largo del RMS. Como se predijo, las células CD11c + tenían la misma densidad en las partes proximales del RMS en ambos grupos (Figura 5A). Sin embargo, la densidad de células CD11c + aumentó en las partes más distales del campo terminal RMS, alcanzando un pico en la capa glomerular ventral del OB, adyacente a la placa cribiforme, después del tratamiento con fingolimod (Figura 5, A y B). Estas observaciones sugieren que la migración de células CD11c + a lo largo del RMS se detuvo en este punto mediante la terapia con fingolimod. A continuación, buscamos determinar si los países en desarrollo realmente migran a lo largo del RMS.

Las células CD11c + se reclutan en el RMS proximal y viajan al OB, y las interrupciones del RMS conducen a su acumulación. (A) Con i.p. tratamiento con fingolimodnorte = 5), la frecuencia de células CD11c + en el RMS proximal (RMS O) se mantuvo sin cambios. Sin embargo, la densidad de células CD11c + aumentó significativamente en el campo terminal del RMS (PAG = 0.042) y se enriqueció aún más en la parte ventral del OB (VOB PAG = 0.014). (B) Secciones representativas del OB ventral que muestran células CD11c + acumuladas en ratones tratados con fingolimod en comparación con controles de vehículo. (C) Los BMDC marcados con CFSE recibieron icv (norte = 3 / grupo). Las células CFSE + (verde) estaban presentes en el RMS medio-proximal (DCX, rojo) a las 16 horas (arriba), y a las 24 horas (abajo) habían alcanzado el OB. (D) Se realizó ablación del RMS con una infusión icv de ARA-c durante 7 días. Hubo significativamente menos CD CD11c + en la región proximal del RMS ablacionado (PAG = 0.04, norte = 3 / grupo). (mi) Sin embargo, en ratones tratados de manera similar, el análisis FACS de células mononucleares del SNC del prosencéfalo mostró un aumento significativo de macrófagos y CD, similar al tratamiento sistémico con fingolimod (PAG = 0.03, norte = 6 2 experimentos independientes). (F) Gráficos de FACS representativos que muestran DC marcadas con CFSE que habían migrado del SNC a CxLN aisladas 48 horas de ratones después de 3 inyecciones icv de BMDC pretratadas con fingolimod (100 nM durante 24 horas), marcadas con CFSE (1 × 10 6 células / inyección) a intervalos de 12 horas (norte = 7 / grupo, 2 experimentos independientes). (GRAMO) El tratamiento de las CD con fingolimod redujo significativamente su migración a CxLN (PAG = 0.042, norte = 7 2 experimentos independientes). Barras de escala: 100 μm 10 μm (recuadros). Los datos representan la media ± SEM. *PAG & lt 0,05.

Los DC migran a través del RMS. Las CD se generaron cultivando BM murina con ligando de tirosina quinasa 3 similar a fms (FLT3) (28), que produjo una población de células CD11c + altamente enriquecida (& gt95% de pureza) después de 9 días en cultivo. A continuación, estas CD derivadas de BM (BMDC) se marcaron ex vivo con CFSE, después de lo cual se inyectaron 10 6 células marcadas icv. Los ratones murieron 16 o 24 horas después de la inyección (norte = 3 por grupo). A las 16 horas, se observaron CFSE + BMDC en el RMS proximal y medio, como se muestra mediante tinción para doblecortina (DCX Figura 5C y ref. 29). A las 24 horas, las células marcadas habían limpiado el RMS proximal y medio y se vieron en el campo terminal del RMS dentro del OB. Para confirmar que el RMS estaba inequívocamente implicado en la migración de DC desde el RMS proximal al distal, lo ablamos con una infusión icv de citosina-β-D-arabinofuranósido (ARA-c) (30). En múltiples experimentos, esto condujo a la retención de DC y macrófagos en el cerebro (Figura 5E), similar al tratamiento sistémico con fingolimod de animales canulados con icv. Además, la cuantificación directa de los países en desarrollo en el RMS mostró que la ablación de la zona subventricular y el RMS condujo al fracaso del reclutamiento de los países en desarrollo en el RMS (Figura 5D). Como CXCL12 normalmente media la migración de neuroblastos a través del RMS (31), tratamos a ratones sistémicamente con AMD3100 para inhibir uno de sus receptores, CXCR4. Este tratamiento dio como resultado un aumento aislado de las CD en el SNC del ratón (Figura complementaria 3), similar al observado con el tratamiento sistémico con fingolimod (Figura 4C). Finalmente, tratamos las BMDC ex vivo con fingolimod o vehículo y las inyectamos icv como antes, 48 ​​horas después de las cuales se aislaron las CxLN. Estos mostraron que el fingolimod actuó directamente sobre las CD transferidas adoptivamente, reduciendo su salida del SNC a las CxLN (Figura 5, F y G). Estos datos confirmaron que las CD migran a través del RMS, posiblemente usando señales quimiotácticas mediadas por CXCR4. A continuación, evaluamos el efecto de perturbar esta vía celular sobre la enfermedad inflamatoria autoinmune del SNC.

La infusión de fingolimod al RMS aumenta la gravedad de la EAE inducida activamente. La administración sistémica de fingolimod inhibe la enfermedad de EAE (32). Por el contrario, descubrimos que la administración dirigida de fingolimod al RMS (Figura 6A) condujo a una dosis relacionada incrementar en la gravedad de EAE activamente inducida con glucoproteína de oligodendrocitos de mielina35–55 (GATITO35–55) péptido (Figura 6B). Las infusiones de la misma dosis de fingolimod, ya sea icv en el ventrículo lateral, en un sitio parenquimatoso del SNC distante del RMS (hipocampo) o sistémicamente, produjeron reducciones relativas en la EAE clínica (Figura 6, C y D). Juntos, estos datos sugirieron que la modulación del tráfico de células inmunes a través del RMS conduce a una inmunorregulación alterada del SNC. Dado que el tratamiento con fingolimod del RMS condujo a una desviación de las respuestas inmunitarias reguladoras y una mayor inmunidad anti-SNC, investigamos a continuación si la administración dirigida de este fármaco podría inducir EAE espontánea.

El tratamiento dirigido con RMS-fingolimod aumenta la gravedad de la EAE inducida por MOG. (A) Tratamiento con RMS-fingolimod. Se implantaron cánulas cerca del origen del RMS (arriba), en el ventrículo lateral (abajo del LV) o en la formación del hipocampo (no mostrado). El fingolimod se administró durante un período de 4 semanas a través de una minibomba osmótica. Sept, septum. (B) El tratamiento con RMS-fingolimod que comenzó una semana antes de la inducción de EAE dio lugar a un aumento dependiente de la dosis en la gravedad de la enfermedad (norte = 3 / grupo), y los ratones que recibieron 300 ng / d murieron todos el día 15. Los animales que recibieron 30 ng / d se vieron menos afectados, pero de manera confiable más que los controles infundidos con vehículo (PAG & lt 0,001). (C) Ratones que recibieron icv fingolimod (300 ng / d norte = 3) desarrollaron EAE significativamente menos graves que los controles de vehículos (PAG = 0.004). (D) La infusión de fingolimod en el hipocampo o sistémicamente también resultó en una enfermedad clínica más leve en comparación con el tratamiento con RMS-fingolimod (norte = 3 por grupo PAG & lt 0,001). *PAG & lt 0,05.

La infusión de fingolimod al RMS aumenta la incidencia espontánea de EAE. Si bien la mayoría de las células Th de los ratones 2D2 C57BL / 6 transgénicos del receptor de células T Vβ11 responden a MOG, muestran una tasa baja de enfermedad espontánea en todo el SNC. Mientras que hasta el 30% de los ratones 2D2 desarrollan neuritis óptica durante un período de 3 meses, solo alrededor del 6% llega a desarrollar EAE clásica espontánea (en lugar de optoespinal) (33, 34). La ruptura de la tolerancia inmunitaria en ratones 2D2 (con tratamiento con toxina de tos ferina sola) aumenta significativamente la incidencia de EAE hasta aproximadamente un 60%, mientras que la vacunación con MOG (sin tratamiento con toxina de tos ferina) no induce EAE (34). Dado que una de las principales acciones de la toxina pertussis es modificar la migración de las células inmunitarias (35), planteamos la hipótesis de que las células inmunitarias asociadas con el RMS pueden restringir las respuestas inmunitarias anti-SNC sistémicas en ratones 2D2. Para probar esta afirmación, administramos fingolimod o vehículo dirigido directamente al RMS (denominado en el presente documento tratamiento con RMS-fingolimod y RMS-vehículo, respectivamente). Cohortes separadas recibieron fingolimod o vehículo a través de RMS e infusión icv, o directamente a los CxLN a través de s.c. linfáticos (36), este último sin pasar por el SNC. RMS-fingolimod condujo a una incidencia del 63% de EAE clásica (10 de 16 ratones) en comparación con los ratones de control con vehículo RMS (0 de 9 PAG & lt 0,001). Además, no hubo ningún caso de EAE en ratones a los que se les infundió fingolimod o vehículo en el ventrículo lateral (norte = 4) oa los CxLNs (norte = 11). Entre los 10 ratones que desarrollaron síntomas de EAE, las puntuaciones clínicas variaron de 1 a 5 (media ± SEM, 2,0 ± 0,4 Figura 7A). Estos datos confirmaron la capacidad única de la administración de RMS-fingolimod para inducir EAE en esta línea de ratones resistentes.

El tratamiento con RMS-fingolimod induce EAE al interrumpir la función de CxLN Treg. (A) La incidencia de EAE en ratones 2D2 aumentó del 0% con el tratamiento con vehículo RMS (norte = 9) a 63% (10 de 16 4 experimentos independientes) con tratamiento con RMS-fingolimod. (B) Estos ratones también tenían más células T específicas de antígeno en la médula espinal (1,7 ± 0,1 × 10 5 frente a 0,4 ± 0,2 × 10 5 PAG = 0.03 3 experimentos independientes) y (C) la relación Treg / Teff en las CxLN se relacionó negativamente con las células T específicas de antígeno en la médula espinal (SC norte = 6 PAG = 0,002 3 experimentos independientes (véanse también las Figuras complementarias 6 y 7). (D y mi) Tampoco tuvieron diferencias en (D) el número de Treg específicas de antígeno entre CxLN e ILN (CxLN, PAG = 0,9 ILN, PAG = 0,5) o en (mi) la proporción de Teffs específicos de antígeno como porcentaje del total de células T (CxLN, PAG = 0,6 ILN, PAG = 0.3). (F) RMS-fingolimod o el tratamiento directo con CxLN fingolimod no afectó la proporción de Teffs (PAG = 0.6 norte = 6 2 experimentos independientes). (GRAMO) Separe los ratones 2D2 tratados con RMS-fingolimod o RMS-vehículo (norte = 9 3 experimentos independientes) tuvieron su actividad Treg evaluada en sus CxLNs (ver Métodos y Figuras Suplementarias 8 y 9). Hubo un aumento significativo en la activación de células T específicas de antígeno cuando se eliminaron CD25 hi Tregs de la población mononuclear CxLN (PAG = 0.023) de aislados de CxLN tratados con RMS-vehículo, pero no tratados con RMS-fingolimod, a diferencia de los ILN (norte = 18 3 experimentos independientes), indicativo de actividad Treg reducida en los CxLN de ratones tratados con RMS-fingolimod. Los datos representan la media ± SEM. *PAG & lt 0,05.

También cuantificamos las células T Vβ11 + específicas del SNC en la médula espinal de ratones 2D2 que recibieron tratamiento dirigido a RMS; esta área está afectada en la EAE clásica, pero distante del sitio de infusión. El análisis FACS de las células mononucleares de la médula espinal reveló que el número absoluto y la proporción de células T Vβ11 + fue significativamente mayor en ratones infundidos con fingolimod frente a con vehículo (Figura 7B y Figura complementaria 5B), de acuerdo con un aumento de la neuroinflamación.

La función de Treg está comprometida en los CxLN de ratones tratados con RMS-fingolimod. Los CxLN se recolectaron de ratones 2D2 no tratados o de aquellos sometidos a tratamiento con RMS-fingolimod o RMS-vehículo. Para identificar Tregs, se tiñeron células CxLN de ratones no tratados con CD3, CD4, CD25, CD127 y FoxP3. Esto mostró que la mayoría, si no todas, las células CD25 + CD127lo expresaron FoxP3 (Figura complementaria 6), identificándolas como Tregs inducibles por hueso. A continuación, determinamos la proporción de células efectoras T específicas de antígeno (Teffs) y Tregs en los CxLN de los ratones 2D2 tratados. Teñimos las células con anti-CD45, -CD3, -CD4, -CD44, -CD62L, -CD25 y -CD127 además de un anticuerpo Vβ11 para identificar las células T transgénicas específicas de MOG (Figura complementaria 7). Si bien la proporción de CxLN CD25 hi CD127 lo Tregs no fue significativamente diferente entre los ratones tratados con vehículo o fingolimod (Figura 7D), la relación Vβ11 + Treg / Teff en los CxLN se relacionó de manera significativa e inversa con la proporción de células específicas del SNC en la medula espinal (PAG = 0,002 Figura 7C y Figura complementaria 7), siendo esta última una medida cuantitativa de la gravedad de la enfermedad EAE. Como las células T específicas de antígeno se activan en las CxLN antes de migrar al SNC (14), y las Tregs modulan esta activación (37), planteamos la hipótesis de que el tratamiento con RMS-fingolimod causa un déficit en la función de Treg en las CxLN, lo que mejora la acción anti -Respuestas inmunes al SNC.

La administración de RMS-fingolimod rompe la tolerancia inmune del SNC. Para determinar si la función de CxLN Treg se vio comprometida después de la infusión de RMS-fingolimod de ratones 2D2 tratados, comparamos directamente el efecto de la depleción de Treg sobre la activación de células T CxLN específicas de antígeno in vitro. El agotamiento de Treg se logró dejando o eliminando células CD25 hi de la preparación de células mononucleares derivadas de CxLN (Figura complementaria 8). Este enfoque se diseñó para medir la capacidad funcional de CD25 hi CD127 lo Tregs inducibles por DC (revisado en la ref. 38). Si bien reconocemos que este enfoque también elimina los CD25 + Teffs, la eliminación de estas células predispone contra el aumento de la activación de las células T.No obstante, para excluir cualquier sesgo desigual, cuantificamos la frecuencia de Teff específica de antígeno en los CxLN después del tratamiento con RMS-fingolimod o con el vehículo RMS, así como después de tratamientos similares administrados directamente a los CxLN, y no encontramos diferencias significativas (Figura 7, E y F). El tratamiento con RMS-fingolimod resultó en una restricción significativamente menor de la activación de las células Teff en comparación con el vehículo RMS, como lo indica un menor aumento en la activación específica de antígeno con y sin CxLN Tregs (PAG = 0.02 Figura 7G). Dado que los CxLN de los grupos RMS-fingolimod y RMS-vehículo mostraron el mismo número de Tregs (Figura 7D), estos datos sugieren que CxLN Tregs después del tratamiento con RMS-fingolimod son menos eficientes para suprimir la activación de las células T. En contraste directo, no hubo diferencias significativas en la actividad de ILN Tregs, independientemente del tratamiento (Figura 7G). Como se impidió que las DC en lugar de las células T viajaran a las CxLN desde el SNC, postulamos que las DC mediaron los cambios en la función Treg en las CxLN.

Las CD modifican la inmunidad anti-SNC en las CxLN mediante la regulación de la actividad de Treg. Para determinar si la alteración del tráfico de CC desde el cerebro, como resultado del tratamiento dirigido con fingolimod, media la actividad de Treg alterada en los CxLN, utilizamos un modelo de hipersensibilidad de tipo retardado (DTH). Este modelo es capaz de determinar si las DC modifican las respuestas de Teff específicas de antígeno en las CxLN in vivo (39), y si la actividad de CxLN Treg se modifica de manera similar. En este caso, examinamos si el tratamiento con RMS-fingolimod alteró la capacidad de las CD CxLN para modular las respuestas de las células Th al péptido MOG. Los ratones WT C57BL / 6 se sometieron a una infusión de RMS-fingolimod o RMS-vehículo durante 4 semanas, después de lo cual se recolectaron las CxLN, se aislaron las células mononucleares y se marcaron en la superficie y se purificaron las CD CD45 + CD3 - CD11 + mediante FACS a más de 99% de pureza (Figura complementaria 10). Las CD de un solo ratón (4-8 × 10 4 células) se inyectaron en un pabellón auricular de un ratón C57BL / 6 separado, que había recibido una única s.c. vacunación con péptido MOG en adyuvante completo de Freund 7 días antes. Como control, se inyectó el vehículo acelular en la otra oreja del mismo ratón. Diez días después, ambos oídos fueron desafiados con péptido MOG inyectándolo directamente en el subcutis. Para evaluar las respuestas de recuperación de antígenos mediadas por células T, se midió la inflamación del oído 24 horas después de la exposición (39), y el aumento de la inflamación del oído indica una mayor respuesta. Se consideró que la hinchazón en el oído de control que recibió la inyección de vehículo acelular representaba la respuesta de recuerdo inmune, totalmente atribuible a la vacunación con MOG. La hinchazón de la oreja inyectada con DC se comparó directamente con la oreja de control del mismo ratón y se expresó como un porcentaje de la hinchazón de la oreja de control. En experimentos replicados, las CD aisladas de los CxLN de ratones con tratamiento con RMS-fingolimod mediaron un aumento significativo en las respuestas de recuerdo al antígeno MOG del SNC, lo que confirmó las respuestas inmunitarias anti-SNC mejoradas en los CxLN, mientras que los controles con vehículo de RMS no mostraron tal cambio ( Figura 8A). Las CD aisladas de las CxLN de ratones que recibieron vehículo icv o fingolimod no mostraron capacidad para regular la respuesta de Teff a MOG en las CxLN, como lo indican los grados similares de hinchazón en las orejas inyectadas con vehículo acelular y DC (Figura 8A). Estos datos sugirieron que la salida deficiente de las CD del SNC como resultado del tratamiento con RMS-fingolimod fue responsable de un aumento de las respuestas de recuperación de antígenos del SNC en los CxLN. Sin embargo, no se puede excluir un efecto directo de fingolimod sobre las CD CxLN.

Las CD derivadas del SNC modulan la inmunidad anti-SNC en las CxLN. (A) Las CD de CxLN se purificaron de ratones C57BL / 6 tratados con RMS-fingolimod o -vehículo, o icv fingolimod o vehículo, durante 4 semanas. Estos o el vehículo acelular se inyectaron en cada pabellón auricular de ratones C57BL / 6 separados antes de la evaluación de MOG DTH (ver Métodos). Solo las CD de ratones tratados con fingolimod aumentaron las respuestas de MOG DTH (RMS-fingolimod, norte = 12 / grupo icv fingolimod, norte = 6 / grupo PAG = 0,003 3 experimentos independientes). (B) Se trataron ratones C57BL / 6 separados con fingolimod o vehículo i.p. durante 14 días (norte = 103 experimentos independientes), y las CD del SNC se purificaron con FACS y se probaron en el modelo DTH, que mostró que modificaron de manera similar la DTH y no se alteraron por la exposición directa a fingolimod. (C) Se seleccionaron aleatoriamente 10 ratones (5 vehículo 5 fingolimod) de A, y los CxLN que drenaban el control del vehículo o los oídos tratados con DC se aislaron por separado para la evaluación funcional de Treg. Solo los oídos de drenaje de CxLN que tenían CD de RMS-fingolimod habían reducido significativamente la actividad de Treg (norte = 5 PAG = 0.01). (D) Se aislaron células CNS CD45 hi CD3 - CD11c + CD11b + y CD45 hi CD3 - CD11c + CD11b - de 10 ratones normales, después de lo cual se evaluó cada subconjunto de DC (2 x 10 2 células) en el modelo DTH en ratones separados. Solo CD11b: las CD del SNC redujeron significativamente la DTH a MOG (norte = 10 PAG = 0,011 3 experimentos independientes). (mi) Repetimos el experimento en D, excepto que MOG fue reemplazado por BSA metilado (norte = 3 / grupo). No hubo una modulación significativa de la respuesta de BSA metilada (PAG & gt 0.9), que, en contraste con la modulación mediada por DC de MOG DTH, sugiere un mecanismo específico del antígeno del SNC. Los datos representan la media ± SEM. *PAG & lt 0,05.

Fingolimod no altera la actividad inflamatoria de las CD del SNC. Para probar si los efectos directos de fingolimod sobre la capacidad inflamatoria, en lugar de migratoria, eran los responsables de nuestros resultados, aprovechamos las propiedades farmacocinéticas de fingolimod, que conduce a una concentración preferencial en el SNC después de la terapia sistémica (32). Esto aseguró que cualquier DC aislada del SNC estaría expuesta a fingolimod in vivo. En este caso, los países en desarrollo de los CxLN no pudieron usarse, ya que habíamos demostrado que el tratamiento sistémico con fingolimod probablemente alteraría el tráfico hacia los CxLN y, por lo tanto, sesgaría nuestros resultados. Tratamos grupos de 10 ratones con vehículo o fingolimod (6 μg / d i.p.) durante 7 días. Las CD del SNC se aislaron, como antes, del prosencéfalo con las meninges extraídas (Figuras complementarias 2 y 10). Luego comparamos su capacidad para modular las respuestas de recuperación de antígenos del SNC utilizando el modelo DTH. No hubo diferencias significativas en las respuestas de recuperación cuando las CD se aislaron de ratones tratados con vehículo o fingolimod y posteriormente se entregaron a las CxLN (Figura 8B), lo que sugiere que los efectos directos de fingolimod en las CD no alteraron su capacidad para modular la inflamación . Habiendo descartado un efecto directo de fingolimod en las CD, y considerando nuestra observación de la función de Treg alterada en las CxLN como resultado del tratamiento con RMS-fingolimod, examinamos a continuación si las CD transferidas adoptivamente modulan directamente la función de Treg en las CxLN.

Los DC modulan directamente la función Treg en los CxLN. Para determinar que las CD transferidas modulan la inmunidad anti-SNC regulando la actividad de CxLN Treg, examinamos ratones que tenían CD de CxLN transferidas al oído. Después de la exposición a MOG (Figura 8A), las orejas inyectadas con DC y con vehículo tenían sus CxLN de drenaje aisladas por separado, después de lo cual se determinó la actividad de Treg, como lo habíamos hecho antes (Figura 7G). La actividad de Treg fue significativamente menor en los CxLN que recibieron CD de RMS-fingolimod en comparación con los ratones tratados con RMS-vehículo (Figura 8C). Por lo tanto, estos datos respaldan la afirmación de que el fingolimod restringe la salida de las CD del cerebro que, de otro modo, mejorarían la actividad de Treg. Además, indican que debe haber una subpoblación de DC en el SNC normal que restrinja las respuestas inmunitarias anti-SNC en los CxLN.

Un subconjunto de DC del prosencéfalo restringe la inmunidad anti-SNC. Nuestros datos anteriores sugirieron la presencia de un subconjunto de CD del SNC que suprime las respuestas inmunitarias anti-SNC en los CxLN. Por lo tanto, aislamos las CD del prosencéfalo, donde las CD se concentran a lo largo del RMS (Figuras 1-3), cuidadosamente despojadas de meninges para eliminar las CD asociadas. Las CD restantes, predominantemente asociadas con RMS de 10 ratones normales se purificaron mediante FACS (Figura complementaria 10). Luego probamos la capacidad de CD45 hi CD3 - CD11c + CD11b + y CD45 hi CD3 - CD11c + CD11b - CNS clasificadas para modular las respuestas anti-CNS en nuestro modelo DTH. Las CD aisladas se inyectaron directamente en un oído y el control del vehículo acelular en el otro, de ratones vacunados con MOG, y se midieron las respuestas de recuerdo a MOG. Sólo CD45 hi CD3 - CD11c + CD11b - CD del SNC fueron capaces de reducir significativamente las respuestas de recuperación de antígeno a MOG (Figura 8D). Esta subpoblación de DC incluye pDC que se sabe que aumentan las respuestas de Treg (40). Estos datos confirmaron que el SNC de ratón normal contiene una población de células CD45 hi CD3 - CD11c + CD11b - capaz de suprimir las respuestas anti-SNC en las CxLN. Para mostrar que este efecto era probablemente específico de antígeno, realizamos el mismo experimento pero sustituimos BSA metilada por MOG para vacunación y desafío, y no encontramos una modulación significativa de DTH (Figura 8E). Esta observación sugiere que las CD modulan las respuestas de CxLN de una manera específica del antígeno del SNC.

Muchos estudios han demostrado las propiedades tolerogénicas del parénquima del SNC. Dichos hallazgos, combinados con la identificación de las barreras anatómicas del SNC, sugirieron que los componentes inmunitarios celulares tienen acceso limitado al SNC (2). Sin embargo, estas observaciones no son consistentes con la observación ahora ampliamente aceptada de que las células T están presentes en el SNC normal. Aunque previamente controvertidos (5, 23, 24, 41), nuestros hallazgos actuales indican claramente que las CD CD11c + derivadas de la circulación también pueden acceder a regiones seleccionadas del parénquima sano del SNC, como lo hacen en otros tejidos sólidos. Aquí, identificamos una nueva vía fisiológica del tráfico de DC desde el SNC a los CxLN que regulaba activamente la autoinmunidad del SNC en el compartimento inmunitario periférico. Además, demostramos que esta vía de migración de DC estaba anatómica y funcionalmente asociada con el RMS y susceptible de intervención terapéutica.

La pregunta más pertinente que surge de estos datos es cómo la presencia de CD en el parénquima podría haber pasado desapercibida previamente. Esto probablemente se deba a la práctica común de generar secciones coronales para la mayoría de los propósitos. En esta orientación, el RMS ocupa una proporción muy pequeña de toda la sección. Como la densidad de las CD es relativamente escasa, estas células se perderían fácilmente en este plano de sección. Las secciones sagitales, por otro lado, muestran el curso completo del RMS, lo que permite más fácilmente la identificación de cualquier CD que contenga. Usando este enfoque, mostramos que las CD, habiendo obtenido acceso al ventrículo lateral, migraron a lo largo del camino del RMS (Figura 5C). El origen de las CD asociadas con RMS en el SNC no manipulado no se identificó definitivamente en este estudio, aunque nuestros datos sugirieron que se originan en la circulación (Figura 3) y probablemente ingresan a través del plexo coroideo, en gran parte independientes de los mecanismos que se informó recientemente para regular el reclutamiento de macrófagos en este sitio (26). Sin embargo, también pueden surgir de una población precursora residente en el SNC descrita recientemente (5). Independientemente de sus posibles puntos de entrada, nuestros hallazgos indicaron claramente que una vez reclutados al RMS, migran al OB distal y luego a los CxLN (Figuras 4 y 5), probablemente accediendo a los linfáticos de la mucosa nasal (Figura 9). y referencias 42 a 44). Allí, interactúan con las células T y regulan la actividad de Treg, que a su vez regula la activación de Teff específica del SNC. La interrupción específica de esta vía en el cerebro con fingolimod impidió que las CD llegaran a las CxLN. Esto tuvo el efecto de romper la tolerancia inmunológica del SNC, lo que provocó una enfermedad neuroinflamatoria.

Vía migratoria de células inmunes a través del RMS. Las CD circulantes se reclutan en la zona subventricular y el RMS, muy probablemente a través del plexo coroideo y / o la vasculatura asociada. Al migrar a lo largo del RMS hacia el OB, estas APC encuentran antígenos del SNC, quizás de progenitores moribundos o neuronas destinadas a ser reemplazadas. Las CD luego salen del cerebro en el término central de RMS en el OB y ​​acceden a las CxLN, donde regulan la inmunidad. Sugerimos que promuevan la diferenciación y / o función de Tregs, que a su vez suprimen las respuestas de Teff de memoria o de células ingenuas autorreactivas anti-SNC en las CxLN. Solo las células Th previamente activadas se reclutan en el SNC. NC, corteza neural CB, cerebelo.

En experimentos en los que hubo inserción de cánula en el SNC, el tratamiento sistémico con fingolimod evitó que tanto los macrófagos como las CD abandonaran el SNC (Figura 4). Parece probable que esta acumulación de macrófagos se produjera como consecuencia de la inserción de la cánula, que inevitablemente provoca alguna lesión cerebral. En el SNC no lesionado, el tratamiento sistémico con fingolimod y AMD3100 dio como resultado la acumulación de CD solas, aparentemente porque se les impidió salir del SNC (Figura 4C). Curiosamente, la ablación del RMS con ARA-c también impidió la salida celular del SNC, quizás identificando un papel para el tráfico de células inmunes a lo largo del RMS en la resolución de la inflamación del SNC. La acumulación de células inflamatorias y la prevención de su salida en la inflamación continua asociada con las placas activas de EM pueden proporcionar una explicación del creciente número de eventos adversos asociados con el tratamiento con fingolimod en la EM (45). Sin embargo, la identidad de las células inflamatorias que podrían ser perjudiciales en este contexto no está clara. Se puede especular que se trata de macrófagos asociados con lesiones continuas en placas de EM.

La asociación de APC, al igual que las CD, con una vía neurogénica como el RMS puede parecer sorprendente, aunque debe tenerse en cuenta que el RMS se organiza alrededor de la pared del ventrículo olfatorio (o restos del mismo). Se esperaría que estas CD participaran en las actividades inmunorreguladoras del SNC, como ocurre en otros órganos sólidos, al migrar a los LN drenantes y regulando las células inmunes como las Tregs (11). Sin embargo, debemos señalar que no hemos examinado los espacios de Virchow-Robin, que también albergan interacciones de células DC-T (46). En cualquier caso, al igual que en otros órganos sólidos, nuestros datos sugieren fuertemente que la supresión de las respuestas anti-CNS en las CxLN está mediada por DC que han viajado desde el CNS. Un apoyo adicional para esta afirmación fue nuestro hallazgo de que las CD, por sí solas, viajando a las CxLN, mediaban cambios en la respuesta inmune a los antígenos del SNC. Demostramos esto mostrando respuestas inmunes del SNC reducidas en el CxLN de un ratón receptor después de recibir CD11c + CD11b - DC aisladas del SNC de un ratón normal (Figura 8D).

Un trabajo reciente ha identificado las CxLN como un sitio principal de activación de las respuestas inmunes anti-SNC en la EM (13, 47). Los antígenos entregados al SNC se drenan a los CxLN, donde son procesados ​​por las DC (7). Las CD inyectadas en el parénquima cerebral también migran a CxLN (14). Luego, los linfocitos T específicos del SNC se activan en los CxLN antes de su migración al SNC (14). La prevención de la migración de DC a los CxLN a través del tratamiento dirigido con RMS-fingolimod dio como resultado una función de Treg deteriorada, lo que aumentó sustancialmente la incidencia de EAE espontánea en ratones 2D2 por lo demás resistentes. La incidencia de EAE en ratones 2D2 (Figura 7A) fue similar a la observada con el tratamiento con toxina pertussis, que también se sabe que inhibe la migración de células inmunes (34). La falta de inducción de EAE cuando el fingolimod se administró directamente a los CxLN a través de s.c. linfáticos indica que es poco probable un efecto directo de fingolimod sobre los CxLN. Además, la focalización amplia de las células inflamatorias meníngeas, otras células del SNC parenquimatosas similares, o todo el SNC (32) por la administración icv, hipocampal o sistémica de fingolimod, respectivamente, no aumentó la neuroinflamación, no indujo EAE y / o no medió cambios en DTH. Esto confirmó que para que el fingolimod aumente la neuroinflamación, es necesario apuntar específicamente al RMS (Figuras 5-7). Si bien es posible que el antígeno liberado por traumatismo del SNC como resultado del tratamiento con fingolimod dirigido pueda inducir EAE, esto parece poco probable. Los ratones de control fueron tratados de manera similar y no recibieron EAE, a pesar de la liberación de posibles antígenos. La vacunación directa de ratones 2D2 con péptido MOG sin toxina pertussis tampoco induce EAE (34). Además, la literatura disponible con respecto al fingolimod indica que su acción directa sobre el SNC y las células inflamatorias, incluidas las Tregs, reduciría la gravedad y la incidencia de EAE (48). Finalmente, mostramos que los efectos de fingolimod en las CD del SNC no alteraron su regulación de la inflamación en los modelos que usamos, pero afectaron directamente su migración. Por lo tanto, nuestros datos actuales indican que los pDC asociados con el RMS son el objetivo de fingolimod, lo que les impide acceder a los CxLN. El déficit resultante condujo a cambios en la función de Treg e indujo la activación de Teff que causó exacerbación o inducción de EAE.

Es probable que las CD también desempeñen un papel en el beneficio recientemente descubierto del alemtuzumab, un anticuerpo terapéutico monoclonal que se encuentra actualmente en ensayos para el tratamiento de la EM. Alemtuzumab promueve la diferenciación de pDC y la expansión de Treg (15). Se sabe que las pDC promueven la expansión de Treg en modelos animales de EM (40). La modificación inmunitaria adicional a través del tratamiento con alemtuzumab parece mejorar la autoinmunidad protectora anti-SNC en la EM, produciendo un factor neurotrófico derivado del cerebro que elabora células T en la periferia, un efecto que probablemente esté mediado por las CD. También encontramos que el subconjunto de países en desarrollo que regulaban negativamente las respuestas inmunitarias del SNC en los CxLN también era probable que contuviera pDC, que son CD11c + CD11b -. Aunque nuestros estudios actuales se realizaron en ratones, los CxLN regulan la inmunidad en la enfermedad neuroinflamatoria humana (13), y el RMS también se ha definido anatómicamente en humanos (49). Aunque ha habido controversia con respecto a la función neurogénica del RMS en humanos adultos (49 - 53), su papel como conducto para otros tipos de células aún no se ha explorado, y la distribución de las CD parenquimatosas del SNC en humanos es similar a la de visto en ratones (5, 32).

Por último, la vía migratoria de células inmunes RMS es capaz de ser manipulada, como lo indica nuestra entrega de CD singénicas a los CxLN. Esto demostró la viabilidad de administrar terapias locales que, en última instancia, influyan en la función inmunitaria a nivel de las CxLN para tratar la enfermedad neuroinflamatoria. La principal ventaja de estos enfoques terapéuticos localizados es que podrían administrarse dosis significativamente más bajas de fármaco para lograr concentraciones elevadas en los sitios clave de acción, al tiempo que se minimizan los efectos secundarios sistémicos adversos relacionados con la dosis.Estos datos proporcionan un mecanismo potencial por el cual el fingolimod podría causar un resultado adverso en la EM, pero ante todo, revisan notablemente nuestra comprensión de las vías del tráfico de células inmunes a través del SNC y las consecuencias de la intercomunicación entre los compartimentos inmunológico y del SNC en el sistema nervioso central. mantenimiento de la homeostasis del tejido del SNC en salud y enfermedad.

Todos los ratones estaban en el fondo C57BL / 6. Se compraron ratones hembra C57BL / 6, de 6 a 12 semanas de edad, de Australian BioResources. Los ratones transgénicos 2D2 fueron un regalo de V. Kuchroo (Brigham and Women’s Hospital, Boston, Massachusetts, EE. UU. Refs. 33, 34). En Cx3cr1 + / gfp ratones, la secuencia de codificación de EGFP se insertó en el Cx3cr1 región de codificación a través de la eliminación dirigida, lo que hace que el Cx3Receptor CR1 / fractalkine no funcional, y colocando EGFP debajo Cx3cr1 control del promotor en el alelo mutante (25). Los ratones se alojaron en las instalaciones de pruebas biológicas del Instituto Garvan (BTF) o en las instalaciones para animales del Instituto Salk y se mantuvieron en un ciclo de 12 horas de luz / 12 horas de oscuridad, con comida estándar y agua gratis disponibles. La EAE se indujo y se controló clínicamente como se describió previamente con MOG.35–55 (46). La EAE se puntuó clínicamente utilizando una escala estándar de 1 a 5.

Se implantó una cánula de infusión de calibre 30 (Alzet) en el ventrículo lateral derecho (icv +0,2 mm anteroposterior, +1,0 mm lateral, 2,2 mm de profundidad o 0, +1,0 mm lateral, 2,2 mm de profundidad), el prosencéfalo rostral (RFB) parénquima (+0,7 mm anteroposterior, +1,1 mm lateral, 2,2 mm de profundidad), o el hipocampo (–2,5 mm anteroposterior, +1,0 mm lateral, 2,7 profundidad). Se conectó un tubo de catéter desde la cánula de infusión a una bomba osmótica implantada s.c. Las colocaciones de la cánula se confirmaron post mortem en secciones teñidas para material Nissl (Figura 6A). Para apuntar los CxLN, se hizo una incisión en la base del cráneo y el tubo del catéter se tunelizó debajo del cuero cabelludo, de modo que la punta estuviera en la posición del bregma en la línea media. El tubo del catéter se suturó en su posición, se preparó para asegurar la permeabilidad y se conectó al s.c. bomba de infusión.

Generación de quimeras BM. Las quimeras de BM se generaron como se describió anteriormente (54). En resumen, se irradiaron ratones receptores WT de 6 semanas de edad con 2 dosis de 5,5 Gy, con un intervalo de 14 horas. Donante Cx3cr1 + / gfp se sacrificaron los ratones y se recogió la BM de los fémures y las tibias. Tres horas después de la segunda dosis de irradiación, los ratones receptores recibieron una inyección de 3 a 5 × 10 6 células de médula ósea (en 150 μl de RPMI) i.v. a través de la vena lateral de la cola.

Aislamiento de células mononucleares LN y CNS. Los CNS y LN se extrajeron de los ratones perfundidos con solución salina y se cortaron en trozos de 2 mm antes de la digestión con colagenasa D (2,5 mg / ml) y DNasa I (1 mg / ml) en medio R10 (medio RPMI 1640) suplementado con 10% (v / v) FCS, l-glutamina 2 mM, penicilina 100 U / ml, estreptomicina 100 μg / ml y 2-mecaptoetanol 50 μM durante 45 minutos a 37 ° C. Luego, los tejidos se pasaron a través de un filtro de células, seguido de un gradiente de Percoll (70% / 37%) y 350 gramo centrifugación. Las células mononucleares se retiraron de la interfase, se lavaron dos veces y se resuspendieron en medio R10 suplementado con FCS al 10% (v / v).

Inmunohistoquímica (IHC). El tejido del SNC se examinó mediante IHC e inmunofluorescencia (IF) como se describió anteriormente (46). Brevemente, los ratones se anestesiaron profundamente (1 ml / 2 kg de euta, 17% de pentobarbitona sódica, fenitoína sódica al 2,5%) y se perfundieron a través del ventrículo izquierdo con 10 ml de solución salina al 0,9%, seguido de 150 ml de paraformaldehído al 4% helado en borato de sodio. tampón a pH 9,5 utilizando una bomba peristáltica (Gilson). Se recolectaron cerebros, se fijaron posteriormente en paraformaldehído al 4% durante 5 horas y se crioprotegieron durante 16 horas en sacarosa al 20% / PBS potásico 50 mM (KPBS) a 4ºC. A continuación, se obtuvieron secciones de cerebro congeladas de 30 μm de espesor con un micrótomo deslizante (SM2010R Leica Biosystem). Las secciones se almacenaron en una solución crioprotectora (30% de etilenglicol, 20% de glicol en tampón de fosfato de sodio 50 mM, pH 7,4) a –20 ° C.

El inmunomarcaje doble se realizó como se detalla previamente (46). Brevemente, se trataron secciones de tejido flotante de 30 µm de espesor con peróxido de hidrógeno al 0,3% durante 10 minutos para inhibir la peroxidasa endógena, seguido de 7 minutos de borohidruro de sodio al 1%. Luego, las secciones de tejido se inmunoteñieron con anticuerpo monoclonal contra CD11c (hámster armenio anti-mCD11c 1: 1,000 clon N418, eBioscience) o CD3 (anti-CD3 KT3 1: 1,000 Chemicon) en suero de cabra o burro al 2% y Triton X-100 al 0.3%. . Se incubaron secciones de tejido en anticuerpo primario durante 48 horas a 4 ° C en un balancín orbital (instrumento Ratek de 50 rpm), seguido de tinción secundaria biotinilada (cabra o burro 1: 200 Jackson Immunoresearch) en el mismo tampón que el anterior durante 1 hora a temperatura ambiente. Después de la inmunotinción secundaria, las secciones se marcaron con avidina utilizando el kit Vecta Elite (Vector Laboratorie) según el protocolo del fabricante. Después del marcaje con avidina, las secciones se lavaron dos veces (10 minutos por lavado) en acetato de sodio 0,1 M, pH 6, seguido del desarrollo en DAB mejorado con níquel (sulfato de amonio y níquel al 2,5%, acetato de sodio 100 mM, 0,5 mg / ml de DAB, 2 mg / ml de D β-glucosa, 0,4 mg / ml de cloruro de amonio, 1 U / ml de glucosa oxidasa Sigma-Aldrich) durante 5-7 minutos a 4 ° C para el etiquetado de color negro. Las secciones se lavaron 3 veces (10 minutos por lavado) en KPBS y se incubaron con el segundo anticuerpo primario contra CD11c o DCX (sc-8066 Santacruz Biotech) durante la noche, en las mismas condiciones que para el anticuerpo primario inicial, seguido del biotinilado apropiado. tinción secundaria (burro 1: 200 Jackson Immunoresearch) y procedimientos de marcado con avidina. A continuación, las secciones se lavaron dos veces (10 minutos por lavado) con KPBS, y se desarrolló la tinción en DAB sin aumento de níquel (0,5 mg / ml de DAB, 2 mg / ml de D β-glucosa, 0,4 mg / ml de cloruro de amonio, 1 U / ml glucosa oxidasa Sigma-Aldrich) en KPBS para dar un marcaje marrón. Las secciones se montaron en portaobjetos recubiertos con gelatina, luego se deshidrataron y se cubrieron con un cubreobjetos con DPX (Electron Microscopy Sciences). Para la tinción combinada de inmunoperoxidasa e IF, las secciones se marcaron con anti-CD11c y se desarrollaron con DAB potenciado con níquel, seguido de incubación con anti-DCX y con un anticuerpo secundario marcado con FITC específico de especie. Las secciones se montaron sobre portaobjetos recubiertos con gelatina en un tampón de montaje acuoso y se cubrieron con cubreobjetos.

SI microscopía confocal. Las secciones se sometieron a tinción triple IF anti-DCX de cobaya (1: 2000 Millipore), anti-CD11c de hámster armenio (eBioscience 1: 800) y anti-CD11b de rata (1: 500 BD Biosciences) o anti-CD31 de rata (1: : 100 BD Biosciences) en tampón de incubación (PBS 0,1 M que contiene Triton-X100 al 0,3% con suero de burro normal al 2% y suero de cabra normal al 2%) y la tinción se realizó a 4ºC durante 24 horas. Después de lavar con PBS 3 veces, las secciones se sondaron con anticuerpos secundarios marcados con fluoróforo (Jackson ImmunoResearch) a temperatura ambiente (RT) durante 1 hora. La reacción se terminó mediante 3 lavados en PBS, y luego las secciones se montaron y se cubrieron con un cubreobjetos en glicerol al 50% / PBS. Muestras de Cx3cr1 gfp / + Los ratones quiméricos de -a-WT BM se trataron de manera similar, excepto que en su lugar se realizó una tinción doble. Se tiñeron secciones de cerebro de estos ratones con DCX y CD11b o con CD11c y CD11b. Las imágenes confocales se obtuvieron en un microscopio confocal Leica TSC SP y se procesaron con el software Adobe Photoshop CS2 v.9.

Cuantificación y mapeo celular. Para cuantificar y / o mapear las CD, utilizamos material IHC / IF de doble etiqueta, como se describe anteriormente para CD11c con DCX (Figura 1). Las células CD11c + asociadas al RMS (DCX +) se cuantificaron en 6 ratones SPF C57BL / 6 separados, desde su punto de emergencia a nivel de la zona subventricular (en al menos 5 secciones por animal) hasta su entrada al OB. El cuerpo calloso y la corteza frontal en las mismas secciones se examinaron como controles de materia blanca y gris, respectivamente. Los recuentos celulares se corrigieron mediante el método de Abercrombie (55) y la densidad celular se derivó utilizando el área examinada (de reconstrucciones de Neurolucida), definida como el área DCX + para el RMS o como los límites anatómicos del cuerpo calloso y la corteza frontal del mismo. secciones.

Tratos. Para demostrar la migración de leucocitos a través del RMS / CNS hasta los CxLN, los ratones se trataron con vehículo (50% DMSO) o fingolimod (6 μg / d en 50% DMSO) i.p. durante 8 días, comenzando el tratamiento 1 día antes de la colocación de la cánula icv y la infusión de CFSE (1,2 mM en DMSO al 50%) durante 7 días por vía s.c. minibomba osmótica. Se recolectaron células mononucleares del cerebro, CxLN e ILN mientras las infusiones estaban activas. Se marcaron células mononucleares LN con anti-CD45 (BD Biosciences - Pharmingen) solo y se examinaron mediante FACS para mostrar la salida de células CD45 + del SNC. Los leucocitos del SNC se marcaron con un cóctel de anticuerpos (todos de BD Biosciences - Pharmingen), incluidos anti-CD45 (rata PERCP anti-ratón CD45 30-F11), anti-CD3 (pacific blue hamster anti-ratón CD3e 500A2), anti- CD4 (Alexa Fluor 700 rata anti-ratón CD4 RM4-5), anti-CD11c (APC hámster anti-ratón CD11c HL3), anti-CD11b (APC-Cy7 rata anti-ratón CD11b M1 / ​​70), anti-B220 (PE CD45r / B220 RA3-6B2 de rata anti-ratón) y anti-mPDCA-1 (FITC rata anti-ratón PDCA-1 JF05-1C2.4.1) (Figuras complementarias 2 y 4).

Para examinar el efecto de la administración central de fingolimod sobre la gravedad de la EAE, se canularon ratones C57BL / 6 para infusiones icv o RFB (es decir, dirigidas a RMS), recibiendo 30 o 300 ng / d de fingolimod o vehículo (50% DMSO) durante 4 semanas. . Una semana después de iniciar la infusión de fingolimod, se indujo EAE como se describió anteriormente. Los ratones 2D2 recibieron RMS-fingolimod o RMS-vehículo (es decir, infusiones de 300 ng / d de fingolimod o vehículo a través de cánulas dirigidas al RMS). Como control, fingolimod (300 ng / d) se apuntó a los CxLN (sin pasar por el SNC) mediante infusión debajo del cuero cabelludo. Los animales se examinaron para determinar el desarrollo de EAE clínica. Al finalizar el experimento, se perfundió a los ratones y se les extrajo el cerebro y la médula espinal. Después de la fijación, los cerebros se seccionaron y se tiñeron con material Nissl para evaluar la colocación de la cánula.

Para examinar el papel de CXCR4 y CD73, se utilizaron AMD3100 (antagonista de CXCR4 MerckMillipore) y un antagonista de CD73 (adenosina 5 '- [α, β-metileno] difosfato ADP análogo Sigma-Aldrich). El análogo de ADP (0,5 mg en solución salina) se inyectó diariamente i.p. durante 12 días. Los ratones se sacrificaron mientras los tratamientos eran farmacológicamente activos, y las células mononucleares del RFB sin meninges se aislaron y examinaron mediante FACS (Figuras complementarias 2 y 4).

Para la ablación del RMS, se infundió icv ARA-c (Sigma-Aldrich), al 2% en solución salina, durante 7 días por vía s.c. minibomba osmótica. Los ratones se sacrificaron mientras el fármaco estaba activo para el análisis de células mononucleares del SNC o la cuantificación por IHC de células CD11c en el RMS.

Seguimiento de países en desarrollo trasplantados en el RMS in vivo. BM de ratones C57BL / 6 cultivados en presencia de 300 ng / ml de ligando de tirosina quinasa 3 de tipo Fms recombinante murino (FLT3) durante 9 días. La maduración satisfactoria de las DC se confirmó mediante análisis FACS, que demostró que & gt95% de las células eran CD45 + CD11c +. Las células se marcaron ex vivo en CFSE 2,6 µM durante 5 minutos, se lavaron y luego se inyectaron icv (1 x 10 6 células). Para el tratamiento con fingolimod ex vivo, las células se incubaron en cultivo con fingolimod 100 nM durante 24 horas antes del parto. Los animales se sacrificaron 16 y 24 horas después de la inyección, y los cerebros se procesaron como se describió anteriormente para tinción IF para análisis DCX o LN a las 48 horas.

Ensayo de células supresoras de Treg ex vivo. Se recolectaron LN de ratones experimentales, pretratados como se describió anteriormente, y se obtuvieron suspensiones unicelulares pasando el LN a través de una malla de nailon de 70 µm en 1 x PBS que contenía 5% de FCS. Los glóbulos rojos se lisaron en hielo. Para agotar las Treg de la suspensión celular, las células se marcaron con microesferas de biotina-anti-CD25 (Miltenyi Biotec), o las mismas microesferas sin anticuerpo como control de proceso (según las instrucciones del fabricante), y luego se pasaron a través de columnas magnéticas (Figura complementaria 8). ). Las suspensiones celulares con o sin Tregs se incubaron en presencia o ausencia de MOG.35–55 péptido (3 μg / ml) durante 44 horas de estimulación. A continuación, las células se lavaron 3 veces con 1 x PBS y se marcaron con anticuerpos conjugados con fluoróforo para determinar Teffs y Tregs activados usando anti-CD3, -CD4, -Vβ11, -CD25 y CD69 seguido de análisis (Figura complementaria 9).

Análisis FACS. Las células mononucleares se marcaron y analizaron usando un instrumento de citometría de flujo LSR II (BD Biosciences). Para la determinación de los fenotipos celulares aislados del SNC, los eventos se clasificaron como se muestra en las Figuras complementarias 2 y 4. Para determinar la proporción de células T específicas de antígeno presentes en la médula espinal, las células T Vβ11 + CD3 + CD4 + se cuantificaron usando el La estrategia de activación se muestra en la Figura complementaria 5. Se realizó un fenotipado de células mononucleares cerebrales para determinar la proporción de microglía (CD45 int), células T (CD45 hi CD3 + CD4 +/–), DC (CD45 hi CD3 - CD11c +), macrófagos / PMN (CD45 hi CD3 - CD11c - CD11b +) y células B (CD45 hi CD3 - CD11c - CD11b - B220 + Figura complementaria 4) y pDC (CD45 hi CD3 - CD11c - CD11b - B220 + mPDCA-1 + Figuras complementarias 2 y 4). En los LN de ratones 2D2, los Teffs auxiliares específicos de antígeno se definieron como CD45 + CD44 hi CD62L - CD3 + CD4 + Vβ11 +, y los Treg específicos de antígeno se definieron como CD45 + Vβ11 + CD3 + CD4 + CD25 hi CD127 lo (Figuras complementarias 6 y 7 y ref.56).

Aislamiento de CxLN DC y DTH. La capacidad de las CD que migraron del SNC a las CxLN para montar una respuesta inmune específica anti-MOG se investigó utilizando un modelo modificado de DTH (39). En resumen, los ratones C57BL / 6 fueron canulados icv o vía RFB para recibir una infusión continua de fingolimod (300 ng / d) o vehículo durante 4 semanas. Después, los animales se sacrificaron y las células mononucleares eliminadas de CxLN se aislaron como antes mientras las infusiones estaban activas. Las células se marcaron con anticuerpos anti-CD3 y anti-CD11c. La población de células CD3 - CD11c + se clasificó a & gt99% de pureza utilizando el clasificador de células Influx (BD Biosciences) y los parámetros que se muestran en la Figura 9 complementaria. A continuación, se inyectaron las células clasificadas (4-8 x 104 células / 20 μl de medio). en un pabellón auricular de una cohorte separada de ratones C57BL / 6 pre-vacunados con MOG (7 días antes de la inyección de células) se inyectó el otro pabellón auricular con volumen de medio acelular como control. Diez días después de la inyección, ambos pabellones auditivos se expusieron al péptido MOG (50 µg / 20 µl / oreja). El grosor de la oreja se midió antes y 24 horas después de la provocación con MOG utilizando un micrómetro digital. La respuesta de DTH se midió restando el grosor de la oreja antes de la manipulación de la medición 24 horas después de la exposición.

Estadísticas. Como los datos no eran paramétricos, todas las comparaciones se realizaron utilizando la prueba no paramétrica adecuada. Cuando se tomaron medidas en serie a lo largo del tiempo, los grupos se compararon mediante ANOVA de medidas repetidas. El análisis de regresión se realizó mediante el método de Poisson. A PAG un valor inferior a 0,05 se consideró significativo y los valores informados son de 2 colas cuando corresponde.

Aprobación del estudio. Los Comités de Ética Animal del Instituto Garvan o la Universidad de Queensland o el IACUC del Instituto Salk aprobaron todo el trabajo.

D.A. Brown cuenta con el apoyo de Multiple Sclerosis Research Australia, MS Angels Canberra, SpinalCure / NRMA, National Multiple Sclerosis Society USA, Trish Multiple Sclerosis Research Foundation Australia, subvenciones para la infraestructura de desarrollo e investigación de la salud de Nueva Gales del Sur y el NHMRC. EDUCACIÓN FÍSICA. Sawchenko cuenta con el apoyo de la subvención NS-21182 de los NIH, la Clayton Medical Research Foundation y Leona M. and Harry B. Helmsley Charitable Trust (núm. 2012PG-MED002). D.A. Brown es becario de investigación biomédica de NHMRC Australia y becario principal de investigación inaugural de SpinalCure Australia. M.J. Ruitenberg cuenta con el apoyo de una beca de desarrollo profesional de SpinalCure Australia. EDUCACIÓN FÍSICA. Sawchenko es investigador principal de la Clayton Medical Research Foundation. Los autores agradecen a William Sewell por la revisión profunda y la crítica útil del manuscrito durante la preparación.

Conflicto de intereses: Los autores han declarado que no existe ningún conflicto de intereses.

Informacion de referencia: J Clin Invest. 2014124 (3): 1228–1241. doi: 10.1172 / JCI71544.


Abstracto

Los estudios han demostrado por separado que la hipertensión está asociada con la activación de las plaquetas en la periferia (lo que da como resultado la acumulación y una respuesta inflamatoria localizada) y la activación glial en el cerebro. Investigamos la contribución de las plaquetas en la inflamación cerebral, particularmente la activación glial. in vitro y en un modelo de hipertensión en ratas. Encontramos que HTN aumentó la expresión de moléculas de adhesión como JAM-1, ICAM-1 y VCAM-1 en el endotelio cerebral y dio como resultado el depósito de plaquetas en el cerebro. El depósito de plaquetas en ratas hipertensas se asoció con un aumento de CD40 y CD40L y la activación de astrocitos (expresión de GFAP) y microglia (expresión de Iba-1) en el cerebro. Las plaquetas aisladas de ratas hipertensas tenían niveles de sCD40L significativamente más altos e indujeron una activación glial más prominente que las plaquetas de ratas normotensas. La activación de plaquetas con ADP indujo la liberación de sCD40L y la activación de astrocitos y microglia. Además, CD40L indujo activación glial (astrocitos y microglia), señalización inflamatoria NFkB y MAPK, que culminó en neuroinflamación y lesión neuronal (aumento de células apoptóticas). Es importante destacar que la inyección de plaquetas activadas por ADP en ratas normotensas indujo fuertemente la activación de astrocitos y microglia y aumentó los niveles de sCD40L en plasma en comparación con las plaquetas de control. Por el contrario, la inhibición de la activación plaquetaria por Clopidogrel o la interrupción de la señalización de CD40 evitó la activación de astrocitos y microglía y proporcionó neuroprotección en ambos en vivo y in vitro condiciones. Por lo tanto, hemos identificado al CD40L plaquetario como una molécula inflamatoria clave para la inducción de la activación de astrocitos y microglías, los principales contribuyentes a la lesión cerebral mediada por inflamación.


Ver el vídeo: SALVO 2 RATITAS DE LABORATORIO. NUEVAS MASCOTAS. El Gallinero de Mike (Mayo 2022).