Información

1.6: Preparación de la plantilla de ADN para la síntesis del sensor de ARN mutante utilizando una endonucleasa de restricción - Biología

1.6: Preparación de la plantilla de ADN para la síntesis del sensor de ARN mutante utilizando una endonucleasa de restricción - Biología



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

6.1 Objetivo de aprendizaje

En este laboratorio, obtendrá nuestra plantilla de ADN que contiene el ARN sensor mutante listo para la síntesis de ARN. Con este proceso, aprenderá cómo las endonucleasas de restricción (enzimas que escinden el ADN en una secuencia determinada) logran su extraordinaria especificidad.

6.2 Diagrama de flujo del mini proyecto

El bloque en negrita en el diagrama de flujo a continuación destaca el papel del experimento actual en el mini proyecto.

6.3 Sinopsis

El objetivo del mini proyecto era identificar nucleótidos en el sensor de toxinas que son esenciales para reconocer el antibiótico tetraciclina. En la búsqueda de este objetivo, identificó elementos conservados evolutivamente en el sensor y los modificó. Diseñó cebadores para cambiar la secuencia del sensor y creó ADN de sensor mutante mediante amplificación por PCR y preparación de plásmidos. Para probar si estos sensores mutantes son capaces de reconocer la tetraciclina, debe sintetizar los ARN del sensor mutante. Recuerde, el sensor es una molécula de ARN, pero su secuencia está codificada en el genoma al nivel del ADN. El ARN se sintetiza utilizando una plantilla de ADN lineal y una ARN polimerasa. Por lo tanto, el ADN plasmídico que codifica el sensor mutante debe cortarse (linealizarse) utilizando una endonucleasa de restricción. El vector plasmídico se escinde al final de la secuencia del sensor de toxina para evitar que la ARN polimerasa transcriba todo el vector plasmídico en ARN (solo necesita el sensor). Las ARN polimerasas funcionan de manera similar a las ADN polimerasas y aprenderá más sobre ellas en detalle durante el próximo laboratorio.

6.4 ¿Cómo funcionan las endonucleasas de restricción?

La endonucleasa de restricción evolucionó para escindir el ADN intruso, pero deja intacto el ADN del organismo huésped. Los biólogos moleculares los utilizan ampliamente como una herramienta para escindir específicamente plásmidos o in vitro ADN sintetizado durante la clonación. Las endonucleasas de restricción son enzimas que cortan el dsDNA en una secuencia específica con una especificidad de un millón de veces. Esto significa que las endonucleasas de restricción favorecen su secuencia objetivo un millón de veces sobre otras secuencias. ADN afines tienen la secuencia específica y se escinden de manera eficiente mientras que ADN no afines no tienen la secuencia específica y, por tanto, la enzima de restricción no escinde eficazmente. Las enzimas de restricción usan una molécula de agua activada por metal como nucleófilo. La molécula de agua unida al metal es más ácida que una molécula de agua normal. Por lo tanto, el agua unida al metal pierde su protón más fácilmente y se convierte en un grupo hidroxilo. Un grupo hidroxilo es un nucleófilo fuerte y capaz de catalizar la escisión del enlace fosfodiéster de manera muy eficiente (Figura 6.1).

6.5 ¿Cómo logran las enzimas de restricción una especificidad millonaria?

Las endonucleasas de restricción favorecen su secuencia análoga millones de veces sobre otras secuencias. ¿Cómo se logra esta extraordinaria especificidad? Los sitios de escisión de endonucleasas de restricción tienen una simetría doble. Asimismo, las enzimas de restricción son dímeros y tienen simetría doble complementaria (Figura 6.2).

La endonucleasa de restricción forma una red de enlaces de H más extensa con su ADN análogo que con su ADN no análogo. Como resultado, el ADN análogo se dobla (tiene una torcedura en la estructura del dsDNA) y el enlace escindible (el enlace que se escinde) se coloca justo en el medio del sitio activo de la enzima para la escisión. La energía necesaria para doblar el ADN análogo proviene de la extensa unión de H entre la enzima de restricción y el ADN análogo (Fig. 6.3; Figura 6.4).

6.6 ¿Cómo juzgamos si el ADN plasmídico se linealiza con éxito?

La electroforesis en gel de agarosa es una técnica poderosa para separar el ADN según su tamaño y / o forma (consulte el Capítulo 5). Dado que el ADN plasmídico que codifica el ARN sensor mutante fue sintetizado por bacterias, está superenrollado y compacto. Una vez que este ADN se corta con una endonucleasa de restricción, se corta y, por lo tanto, tiene una forma más alargada. Como resultado, el ADN plasmídico superenrollado (sin cortar) migra más lejos en el gel de agarosa que el ADN linealizado (cortado). Si la linealización del ADN tiene éxito, la muestra que contiene el ADN cortado debe tener una sola banda que migra menos lejos en el gel que la muestra de ADN sin cortar (Figura 6.5).

6.7 ¿Qué vamos a hacer en el laboratorio?

Primero, digerirás el ADN plasmídico que codifica el sensor de toxina mutante con la enzima de restricción BamHI y evaluarás el éxito de la reacción usando electroforesis en gel de agarosa. Mientras el gel está funcionando, eliminará la enzima de restricción mediante extracción con fenol-cloroformo y aumentará la concentración de ADN mediante la precipitación con etanol.

PROTOCOLOS

Las necesidades de reactivos y equipos se calculan por seis equipos de estudiantes. Hay un exceso de ~ 20% incluido.

Equipo / cristalería necesarios

  1. Tres matraces Erlenmeyer tapados con corcho de 100 ml
  2. Tres probetas graduadas de 100 ml
  3. Tres juegos de micropipetas (20-100 μl y 2-20 μl)
  4. Sistema de documentación en gel
  5. Baño de agua (para digestión de restricción) ajustado a 37 ° C
  6. Treinta tubos de centrífuga de 1,5 ml (Eppendorf)
  7. 1 microcentrífuga con capacidad de 10.000 g

Soluciones necesarias

  1. 3 l 1 x TAE (Tris-acetato-EDTA) pH = 8.0
  2. 30 ml de EtBr al 1% o colorante de ácido nucleico equivalente
  3. 20 ml de colorante de carga en gel de agarosa (6x, Biorad)
  4. Escalera de peso molecular de 30 ml 1 kb (Biorad)
  5. 2 ml de fenol: cloroformo: mezcla de alcohol isoamílico
  6. 150 ml de acetato de sodio 3 M, pH = 5,2
  7. 1,5 ml de isopropanol

Digestión de restricción del vector del plásmido pUC19-ykkCD

Cada miembro del equipo realiza una digestión

Mezcle las siguientes soluciones en un tubo de centrífuga

  1. 5 μl de tampón 3 (New England Biolabs)
  2. 5 μl 1 mg / ml de solución de albúmina de suero bovino
  3. 5 μl de enzima de restricción BamHI (New England Biolabs)
  4. 75 μl de ADN plasmídico

Incubar en baño de agua a 37 ° C durante 1 hora.

Electroforesis en gel de agarosa

  1. Pese 1 g de agarosa y colóquelo en el matraz Erlenmeyer tapado provisto.
  2. Añada 100 ml de tampón 1xTAE con una probeta.
  3. Calentar durante 1 min en el microondas, agitar el matraz y enfriar brevemente bajo el agua.
  4. Añada 10 μl de EtBr. (Use guantes. EtBr es mutagénico). Matraz de agitación para mezclar.
  5. Vierta el líquido en el casete de gel y coloque los peines. Un gel de agarosa tarda unos 20 minutos en fraguar.
  6. Una vez que el gel esté listo, cargue sus muestras con una escalera de peso molecular. El gel debe ejecutarse durante 20 minutos con 100 V.
  7. Tome una fotografía del gel utilizando un sistema de documentación de gel.

Cargue los 5 ml de las siguientes muestras mezcladas con 1 ml de colorante de carga en el gel de agarosa

  1. Marcador de peso molecular
  2. ADN plasmídico de la preparación del plásmido (muestra de ADN sin cortar)
  3. ADN plasmídico digerido con las endonucleasas de restricción (ADN cortado)

Extracción con fenol-cloroformo y precipitación con etanol

  1. Agregue 100 μl de mezcla de fenol / cloroformo a su muestra.
  2. Agite en el vórtex durante 20 segundos.
  3. Girar durante 2 min en una microcentrífuga a máxima velocidad.
  4. Desechar la capa inferior. (Este paso elimina la capa orgánica que contiene la endonucleasa de restricción).
  5. Añada 100 μl de cloroformo, agite y centrifugue como antes. Retire la capa inferior. Este paso elimina el fenol residual.
  6. Agregue 10 μl de NaAc 3 M y 100 μl de isopropanol a su mezcla.
  7. Agite la muestra en el vórtex y colóquela en un congelador a -20 ºC para que se precipite.

Notas para el instructor

El experimento del capítulo 6 está diseñado para enseñar a los estudiantes cómo realizar la escisión enzimática del vector plasmídico pUC19-ykkCD utilizando la enzima de restricción BamHI. Se puede usar el mismo protocolo con modificaciones mínimas con un ADN y / o endonucleasa de restricción diferente. La enzima de restricción BamHI se adquirió de New England Biolabs, pero se pueden utilizar otros proveedores. Dos equipos de estudiantes compartieron un gel de agarosa para limitar la necesidad de equipo y maximizar la exposición a esta importante técnica. Si el número de equipos es limitado, seis equipos de estudiantes pueden compartir fácilmente un aparato de gel de agarosa. Dado que la digestión de endonucleasas de restricción lleva una hora, es conveniente comenzar la sesión de laboratorio configurando las reacciones y dando una conferencia previa al laboratorio mientras las reacciones se están desarrollando. Este laboratorio tiene dos descansos mientras el gel de agarosa fragua y funciona. Estos tiempos se pueden utilizar para completar la hoja de trabajo de la endonucleasa de restricción o la electroforesis.

Preguntas previas al laboratorio para la linealización del ADN

Define los terminos siguientes.

  1. Endonucleasa de restricción

  2. Enlace escisil

  3. ADN cognado y ADN no cognado

  4. Para probar la calidad del ADN, debe resolver la muestra de ADN en un gel de agarosa. Necesita 1 l de tampón TAE 1 x (Tris-acetato EDTA) para hacer y procesar un gel de agarosa. Ha comprado 40 x stock tampón TAE concentrado. Describe cómo elaboras la solución de 1 l 1 x TAE necesaria para el gel (muestra tu cálculo).

Esquema del informe de laboratorio y distribución de puntos

1. Varias oraciones que definen el objetivo / propósito de este experimento. Describe la importancia de este experimento dentro del mini proyecto. (3 ptos.)

2. Defina / describa brevemente una endonucleasa de restricción. Explique cómo se logra la especificidad. (4 ptos.)

3. Incluya una copia de su escaneo en gel de agarosa con sus muestras marcadas. (4 ptos.)

4. Informe la concentración de su ADN plasmídico. (2 ptos.)

5. Evalúe el rendimiento del ADN plasmídico en función de la concentración de ADN (cuántos mg de ADN obtuvo). Muestre su cálculo de rendimiento y comente qué tan bueno fue su rendimiento de ADN. (6 ptos.)

6. Evalúe la pureza del ADN plasmídico basándose en el escaneo en gel de agarosa y la lectura 260/280 determinada por absorbancia UV. Explicar. (6 ptos.)

7. Juzgue el éxito de la linealización de su ADN basándose en el escaneo en gel de agarosa. (4 ptos.)

8. Juzgue el tamaño de su ADN plasmídico siempre que la escalera de ADN tenga tamaños: 1000 bp, 2000 bp, 3000 bp, 4000 bp, 5000 bp, 6000 bp, 7000 bp, 8000 bp, 9000 bp, 10,000 bp. (4 ptos.)

9. Conjunto de problemas de electroforesis (17 pts.)

Las endonucleasas de restricción son muy específicas y escinden el ADN en secuencias de nucleótidos específicas. Cuando estas enzimas actúan sobre el ADN grande, se descompone en un conjunto de muchos, muchos fragmentos de diferentes tamaños. La distribución de tamaño de tales fragmentos es esencialmente única para cada ADN diferente. Esta distribución proporciona una "huella digital" de ADN que es única para cada individuo. Las huellas dactilares de ADN se han utilizado para identificar mutaciones genéticas, rastrear rasgos hereditarios, establecer la paternidad y ubicar a los sospechosos en la escena de un crimen.Hay varias técnicas diferentes que dan lugar a una huella de ADN. Algunos de los problemas a continuación describirán técnicas y le pedirán que interprete los resultados.1. (3 pts.) Hay miles de endonucleasas de restricción diferentes, cada una con su propia especificidad. Por ejemplo, BamHI, EcoRI y XhoI tienen las siguientes especificidades (los sitios de escisión están marcados con flechas):Identifique los sitios de escisión en el siguiente ADN (marque cada sitio con una línea y el nombre de la endonucleasa específica):5'CCCGAGGATCCTTAGGAATTCATCTA3'3'GGGCTCCTAGGAATCCTTAAGTAGAT5'2. (4 pts.) Muestre la secuencia de los fragmentos de producto de la escisión de BamHI. ¿Por qué se dice que estos productos tienen "extremos pegajosos"?3. (6 pts.) El polimorfismo de longitud de los fragmentos de restricción (RFLP, a menudo pronunciado "riflip") es la forma más antigua de huellas dactilares de ADN. Depende del hecho de que el ADN de cada individuo tiene muchos segmentos con secuencias únicas. Cada segmento puede tener una variedad de secuencias que son heredables. Esta característica se denomina "polimorfismo". Polimorfismo significa que cada individuo tiene ADN con diferentes sitios de escisión de enzimas de restricción. Brevemente, RFLP implicaTratar el ADN con una endonucleasa de restricción específica;Separar los fragmentos resultantes por tamaño en un gel de agarosa;Visualización de fragmentos específicos utilizando sondas de ADN complementarias.Se utilizó el siguiente gel de agarosa para establecer la paternidad. Se generó utilizando RFLP de locus único. Es decir, la sonda utilizada era sensible a un solo segmento polimórfico en el ADN.Para interpretar estos resultados necesitas saber- Cada individuo lleva dos copias de ADN y, es decir, hay dos polimorfismos diferentes para cada segmento de ADN;- Cada individuo hereda una copia de ADN de cada padre.http://www.biology.arizona.edu/)una. ¿Hay hijos que no parezcan ser hijos biológicos de estos padres? Explicar.B. ¿Qué debe ser cierto de la huella dactilar de ADN del niño para establecer que está relacionado con la madre y el padre?4. (4 pts.) En las siguientes huellas dactilares de ADN, C / AF Mix es un carril que contiene tanto el ADN del presunto padre como el del niño.(Cortesía de Genelex Corporation)¿Se prueba la paternidad en cualquier caso? Explica brevemente.5. (6 pts.) La PCR se ha combinado con RFLP para aumentar la sensibilidad de las huellas dactilares del ADN. En esta técnica, la PCR amplifica un segmento de ADN específico de interés. Luego, RFLP identifica los cambios en la secuencia.Por ejemplo, la anemia de células falciformes se puede diagnosticar mediante esta técnica. La anemia de células falciformes es causada por una sola mutación en el ADN que codifica una de las cadenas de proteínas de la hemoglobina. Esta mutación también elimina un sitio de escisión de endonucleasa de restricción para la enzima; Cvn. La pérdida del sitio de escisión es entonces un diagnóstico del gen de células falciformes.A continuación, una madre, un padre y sus hijos han sido examinados para detectar el gen de la anemia falciforme mediante huellas dactilares de ADN. El diagrama sobre el patrón de electroforesis muestra a los padres (fila I) y a los niños (fila II). Las hembras están simbolizadas por un círculo y los machos por un cuadrado. El gen normal se indica con un símbolo abierto y el gen de células falciformes con el símbolo relleno. (Recuerde que cada individuo porta dos copias del gen).El símbolo de cada individuo corresponde a un carril en el gel de electroforesis. Los carriles también están marcados con "S" para la presencia de la mutación de células falciformes y "A" para la presencia del gen normal. (La escalera de ADN está a la derecha y se indica en número de bases. Tenga en cuenta que el gel está "al revés", los fragmentos más pequeños están más cerca de la parte superior).(Cortesía del Dr. Carole Ober)Estime el tamaño de los fragmentos de escisión que solo están presentes en el individuo sin la mutación de células falciformes. Explique brevemente su elección.¿De qué banda proceden estos fragmentos de hendidura? ¿Puedes identificar la banda y estimar su tamaño? Explica tu razonamiento.El investigador diagnosticó a estos sujetos (SS, AS o AA) basándose en esta electroforesis. ¿Ve alguna inconsistencia en el diagnóstico? Explica brevemente.

Diseñe cebadores para mutagénesis convencional (cortar y pegar) para colocar el sensor de toxina ykkCD en el vector de clonación pUC19. Experimentos como este suelen ser el primer paso para estudiar una proteína o ARN en el laboratorio. La secuencia del sensor de toxina y el mapa del vector de clonación se dan a continuación.Secuencia de ADN del sensor ykkCD:TgtaaagttttctagggttccgcatgtcaattgacatggactggtccgagagaaaacacatacgcgtaaatagaagcgcgtatgcacacggagggaaaaaagcccgggagagMapa del vector de clonación pUC19El sensor de toxina ykkCD debe insertarse en pUC19 usando una parte del vector de clonación llamado sitio de clonación múltiple o MCS policonector. Esta parte del vector de clonación contiene sitios de corte para varias enzimas de restricción y está diseñada para permitir la inserción de la secuencia de ADN. En el caso de pUC19, las enzimas de restricción disponibles son: EcoRI, SacI, KpnI, SmaI, BamHI, etc.Para completar la tarea de pegar la secuencia ykkCD en pUC19, responda las siguientes preguntas:1. El primer paso en un proyecto de clonación convencional es elegir un par de enzimas de restricción de las del MCS policonector que no escinden la secuencia de interés (el sensor ykkCD). Las enzimas de restricción que cortan la secuencia ykkCD no se pueden usar para la clonación, porque escindirían la secuencia de interés y no permitirían pegar la secuencia completa en el vector de clonación. Para seleccionar las endonucleasas de restricción adecuadas, siga los dos pasos siguientes.una. Pegue la secuencia del sensor ykkCD en un programa llamado Webcutter (http://www.firstmarket.com/cutter/cut2.html). Enumere los nombres de las enzimas de restricción que no cortan la secuencia ykkCD.B. ¿Qué enzimas del policonector MCS se pueden utilizar para realizar su proyecto de clonación? Proporcione una breve explicación.2. Diseñe cebadores para realizar el experimento de clonación.una. Proporcione las secuencias de imprimación superior e inferior. Explique brevemente cómo diseñó estos cebadores. ¿Con qué parte del ADN se aparean estos cebadores? Recuerde, existe una diferencia entre Quickchange y PCR convencional.B. Calcular la TMETRO (temperatura de fusión) para cada imprimación. Puede usar la calculadora Oligo (http://www.basic.northwestern.edu/biotools/oligocalc.html) para predecir TMETRO.C. La PCR convencional requiere la adición de la secuencia especial reconocida por cada enzima de restricción llamada sitio de restricción. Puede encontrar la secuencia de reconocimiento para cada enzima de restricción en http://www.neb.com.Sus secuencias de cebadores revisadas deben seguir este patrónSecuencia del sitio de restricción + secuencia del cebador de "b".D. Escriba la secuencia de ambos cebadores en la dirección de 5 'a 3'.


Ver el vídeo: FUNCIONES DEL ARN NO CODIFICANTE ncARN (Agosto 2022).